Abstract
Table of contents
Ascomycota Caval.-Sm.
Dothideomycetes sensu O.E. Erikss & Winka
Asterinales M.E. Barr ex D. Hawksw. & O.E. Erikss
Stictographaceae D.Q. Dai & K.D. Hyde
Proliferirostrum Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Proliferirostrum licualicola Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Botryosphaeriales C.L. Schoch, Crous & Shoemaker
Botryosphaeriaceae Theiss. & P. Syd.
Dothiorella Sacc.
Dothiorella sarmentorum (Fr.) A.J.L. Phillips, J. Luque & A. Alves, new host record
Neodeightonia C. Booth
Neodeightonia rattanicola Konta & K.D. Hyde, new host record
Phyllostictaceae Fr.
Pseudofusicoccum Mohali, Slippers & M.J. Wingf.
Pseudofusicoccum trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Hysteriales Lindau
Hysteriaceae Chevall.
Gloniopsis De Not.
Gloniopsis coryphae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Monoblastiales Lücking, M.P. Nelsen & K.D. Hyde
Eriomycetaceae Huanraluek & Hyde
Heleiosa Kohlm., Volkm.-Kohlm. & O.E. Erikss
Heleiosa brunnea Y.R. Sun, Yong Wang bis & K.D. Hyde, new host record
Heleiosa phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Phellinocrescentia Crous & Decock
Phellinocrescentia caryotae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Pleosporales Luttr. ex M.E. Barr
Aigialaceae Suetrong, Sakay., E.B.G. Jones, Kohlm., Volkm.-Kohlm. & C.L. Schoch
Fissuroma J.K. Liu, Phook., E.B.G. Jones & K.D. Hyde
Fissuroma caryotae Wanas., E.B.G. Jones & K.D. Hyde, new host record
Anteagloniaceae K.D. Hyde, Jian K. Liu & A. Mapook
Anteaglonium Mugambi & Huhndorf
Anteaglonium caryotae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Bambusicolaceae D.Q. Dai & K.D. Hyde
Corylicola Wijesinghe, Camporesi, Yong Wang bis & K.D. Hyde
Corylicola coffeae L. Lu, K.D. Hyde & Tibpromma, new host record
Dictyosporiaceae Boonmee & K.D. Hyde
Dictyocheirospora M.J. D’souza, Boonmee & K.D. Hyde
Dictyocheirospora xishuiensis Y.R. Sun, Yong Wang bis & K.D. Hyde, new host record
Ganzhofusosporaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Ganzhofusospora Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Ganzhofusospora phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Ganzhomycetaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Ganzhomyces Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Ganzhomyces phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Lophiotremataceae K. Hiray. & Kaz
Atrocalyx A. Hashim. & Kaz. Tanaka
Atrocalyx trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Lophiotrema Sacc.
Lophiotrema guineensis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Melanommataceae G. Winter
Byssosphaeria Cooke
Byssosphaeria lataniicola Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Byssosphaeria musae Phookamsak & K.D. Hyde, new host record
Camposporium Harkn.
Camposporium alangii Y.R. Xiong, Manawas. & K.D. Hyde, new host record
Neomassariaceae Ariyaw., Jaklitsch & Voglmayr
Neomassaria Mapook, Camporesi & K.D. Hyde
Neomassaria livistonae S.N. Zhang, K.D. Hyde & Jian K. Liu, new host record
Neomassaria formosana H.A. Ariyaw., Jaklitsch & Voglmayr, new host record
Occultibambusaceae D.Q. Dai & K.D. Hyde
Neooccultibambusa Doilom & K.D. Hyde
Neooccultibambusa calami Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Seriascoma Phookamsak, D.Q. Dai & K.D. Hyde
Seriascoma didymosporum Phookamsak, D.Q. Dai, Karun. & K.D. Hyde, new host record
Phaeoseptaceae Boonmee, Thambugala & K.D. Hyde
Pleopunctum N.G. Liu, K.D. Hyde & J.K. Liu
Pleopunctum phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Pseudomassarinaceae Phukhams. & K.D. Hyde
Pseudomassarina Phukhams. & K.D. Hyde
Pseudomassarina roystoneae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Sulcatisporaceae Kaz. Tanaka & K. Hiray.
Parasulcatispora Phukhams. & K.D. Hyde
Parasulcatispora bismarckiae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Tropicomicromyces Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Tropicomicromyces livistonae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Tropicomicromyces magnoliae (N.I. de Silva & Lumyong) Y.R. Xiong, Manawas. & K.D. Hyde, comb. nov.
Tropicomicromyces palmae (S.N. Zhang, K.D. Hyde & Jian K. Liu) Y.R. Xiong, Manawas. & K.D. Hyde, comb. nov.
Teichosporaceae M.E. Barr
Pseudoteichospora X.G. Tian, K.D. Hyde & Tibpromma
Pseudoteichospora hydei H.Z. Du & Jian K. Liu, new host record
Tetraplosphaeriaceae Kaz. Tanaka & K. Hiray
Tetraploa Berk. & Broome
Tetraploa borassi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Pleosporales genera incertae sedis
Inflatispora Y. Zhang ter, J. Fourn. & K.D. Hyde
Inflatispora licualae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Eurotiomycetes O.E. Erikss. & Winka
Chaetothyriales M.E. Barr
Herpotrichiellaceae Munk
Cladophialophora Borelli
Cladophialophora licualae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Veronaea Cif. & Montemart.
Veronaea pinangae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Sclerococcales Réblová, Unter. & W. Gams
Dactylosporaceae Bellem. & Hafellner
Sclerococcum Fr.
Sclerococcum caryotae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Leotiomycetes O.E. Erikss. & Winka
Helotiales Nannf.
Lachnaceae Raitv.
Proliferodiscus J.H. Haines & Dumont
Proliferodiscus chiangraiensis Ekanayaka & K.D. Hyde, new host record
Orbiliomycetes O.E. Erikss. & Baral
Orbiliales Baral, O.E. Erikss.
Orbiliaceae Nannf.
Orbilia Fr.
Orbilia phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Sordariomycetes O.E. Erikss. & Winka
Chaetosphaeriales Huhndorf, A.N. Mill. & F.A. Fernández
Chaetosphaeriaceae Réblová, M.E. Barr & Samuels
Codinaeella Réblová & Hern.-Restr.
Codinaeella plagiogyriae J.Y. Zhang & Y.Z. Lu, new host record
Fusichloridium W.P. Wu & Y.Z Diao
Fusichloridium licualae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Rattania Prabhug. & Bhat
Rattania pinangae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Helminthosphaeriaceae Samuels, Cand. & Magni
Kramasamuha Subram. & Vittal
Kramasamuha arengae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Conioscyphales Réblová & Seifert
Conioscyphaceae Réblová & Seifert
Conioscypha Höhn.
Conioscypha verrucosa J. Yang & K.D. Hyde, new host record
Pseudoconioscypha Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Pseudoconioscypha licualae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Conlariales K.D. Hyde & Hongsanan
Conlariaceae Huang Zhang, K.D. Hyde & Maharachch.
Conlarium F. Liu & L. Cai
Conlarium thailandense X.D. Yu, H. Zhang & K.D. Hyde, new host record
Diaporthales Nannf.
Cytosporaceae Fr.
Cytospora Ehrenb.
Cytospora phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Cytospora pingbianensis Q.J. Shang, K.D. Hyde & J.K. Liu, new host record
Distoseptisporales Z.L. Luo, K.D. Hyde & Hong Y. Su
Distoseptisporaceae K.D. Hyde & McKenzie
Distoseptispora K.D. Hyde, McKenzie & Maharachch.
Distoseptispora elongata Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Distoseptispora nanchangensis Y.F. Hu & Jian Ma, new host record
Distoseptispora saprophytica W. Dong, H. Zhang & K.D. Hyde, new host record
Distoseptispora yichunensis Y.F. Hu & Jian Ma, new host record
Glomerellales Chadef. ex Réblová, W. Gams & Seifert
Plectosphaerellaceae W. Gams, Summerbell & Zare
Acremoniisimulans Tibpromma & K.D. Hyde
Acremoniisimulans cocois Konta & K.D. Hyde, new geography record
Acrostalagmus Corda
Acrostalagmus luteoalbus (Link) Zare, W. Gams & Schroers, new host record and new geography record
Hypocreales Lindau
Calcarisporiaceae Jing Z. Sun, Xing Z. Liu & K.D. Hyde
Verticimonosporium Matsush.
Verticimonosporium livistonae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Stachybotryaceae L. Lombard & Crous
Alfaria Crous, N.J. Montaño-Mata & García-Jim.
Alfaria cyperi-esculenti Crous, Montaño-Mata & García-Jim., new host record and geography record
Memnoniella Höhn.
Memnoniella ellipsoidea L. Lombard & Crous, new host record
Myrmecridiales Crous
Myrmecridiaceae Crous
Pleurophragmium Costantin
Pleurophragmium pteridophytophilum J.Y. Zhang, K.D. Hyde & Y.Z. Lu, new host record
Pleurophragmium submersum (D.F. Bao, J.C. Kang & Y.Z. Lu) Y.R. Xiong, Manawas. & K.D. Hyde, comb. nov.
Pleurotheciales Réblová & Seifert
Pleurotheciaceae Réblová & Seifert
Phaeoisaria Höhn.
Phaeoisaria clematidis (Fuckel) S. Hughes, new host record
Pseudodactylariales Crous
Pseudodactylariaceae Crous
Pseudodactylaria Crous
Pseudodactylaria caryotae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Rhamphoriales K.D. Hyde & Hongsanan
Rhamphoriaceae Réblová
Xylolentia Réblová
Xylolentia licualae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Sordariales Chadef. ex D. Hawksw. & O.E. Erikss.
Sordariales genera incertae sedis
Rhexodenticula W.A. Baker & Morgan-Jones
Rhexodenticula acaciae Crous, new host record
Sporidesmiales Crous
Sporidesmiaceae Fr.
Sporidesmium Link
Sporidesmium phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Vermiculariopsiellales Hern.-Rest., J. Mena, Gené & Crous
Vermiculariopsiellaceae Hern.-Rest., J. Mena, Gené & Crous
Vermiculariopsis Torrend
Vermiculariopsis pediculata (J.L. Cunn.) Hern.-Restr & Crous, new host record
Xylariales Nannf.
Beltraniaceae Nann.
Beltraniella Subram.
Beltraniella brevis C.G. Lin, Jian K. Liu & K.D. Hyde, new host record
Coniocessiaceae Asgari & Zare
Circinotrichum Nees
Circinotrichum phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Pirozynskiomyces Hern. -Restr. & Crous
Pirozynskiomyces trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Pseudoconiocessia L. Lu & Tibpromma
Pseudoconiocessia arengicola Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Fasciatisporaceae S.N. Zhang, K.D. Hyde & J.K. Liu
Fasciatispora K.D. Hyde
Fasciatispora elaeidis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Fasciatispora sichuanensis L.S. Dissan., K.D. Hyde & J.C. Kang, new host record
Cannoniaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Cannonia Joanne E. Taylor & K.D. Hyde
Cannonia trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Vamsapriyaceae Y.R. Sun, Yong Wang bis & K.D. Hyde
Vamsapriya Gawas & Bhat
Vamsapriya rhapidicola Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Vamsapriya trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Xylariaceae Tul. & C. Tul.
Virgaria Nees
Virgaria nigra (Link) Nees, new host record and geography record
Xylariales genera Incertae sedis
Anthostomella Sacc.
Anthostomella chinensis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Anthostomella umbraculiferae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Calamomyces Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Calamomyces brunneisporus Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Melanographium Sacc.
Melanographium citri (Gonz. Frag. & Cif.) M.B. Ellis, new geography record
Melanographium coryphae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Melanographium elaeidis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Sordariomycetes families Incertae sedis
Junewangiaceae J.W. Xia & X.G. Zhang
Sporidesmiella P.M. Kirk
Sporidesmiella trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Leucocellomycetaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Leucocellomyces Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Leucocellomyces licualae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Pseudoconlariaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Pseudoconlarium N.G. Liu, K.D. Hyde & J.K. Liu
Pseudoconlarium trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Sporodochyalomycetaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Sporodochyalomyces Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Sporodochyalomyces trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov.
Introduction
Palms (Arecaceae) comprise around 2,600 species of arborescent monocotyledons, and constitute both an iconic botanical group and a critical socio-ecological resource across pantropical forest ecosystems (Cámara-Leret et al. 2017, Levis et al. 2017). As keystone components of neotropical rainforest ecosystems, palm species frequently dominate arborescent communities. They constitute over 50% of the emergent tree stratum while modulating forest structure and microclimatic conditions through their distinctive crown architectures and phenological patterns (ter Steege et al. 2013, Reichgelt et al. 2018, Fehr et al. 2020). Palms maintain complex trophic interdependencies by hosting diverse mycota that mediate critical biogeochemical processes (Schuessler et al. 2018, Muscarella et al. 2020, Rathna et al. 2025). The rhizosphere and phyllosphere fungal consortia associated with palms demonstrate specialized enzymatic capabilities for lignocellulose decomposition and phosphorus solubilization, integral to maintaining the nutrient dynamics and carbon sequestration capacities characteristic of these hyperdiverse ecosystems (Nisa et al. 2015, Outamamat et al. 2021, Toapanta-Alban et al. 2022). These Arecaceae-associated fungal assemblages are referred to by the mycological community as “palm fungi” (Fröhlich & Hyde 1999, 2000, Pereira & Phillips 2023a, Xiong et al. 2024, Zhang et al. 2024), a guild formally documented by Kunze & Schmidt (1817).
Over two centuries of investigation have established saprobic taxa colonizing palm substrates as a predominant research focus. With foundational contributions by 19th-century mycologists, including P.A. Saccardo, G. Paoletti, and A.J.O. Penzig, who initiated pioneering taxonomic documentation of saprobic fungi colonizing palm substrates, laying the groundwork for systematic studies (Saccardo & Paoletti 1888, Penzig & Saccardo 1897). Throughout the 20th century, P. Hennings, H. Rehm, H. Sydow, P. Sydow, M.B. Ellis, K.A. Pirozynski, F.C. Deighton, and their collaborators expanded these foundations through morphological analyses, addressing critical gaps in species diversity and biogeographic distributions (Hennings 1902, Rehm 1914, Sydow & Sydow 1917, Ellis 1957, 1967, Pirozynski 1972, Deighton 1985). The late 20th and early 21st centuries marked a paradigm shift as K.D. Hyde, J. Fröhlich, E.H.C. McKenzie, W.H. Ho, U. Pinruan, E.B.G. Jones, J.E. Taylor, A. Pinnoi, J.K. Liu, and colleagues established this field as a focal point in mycology and pioneered molecular-based taxonomy (Hyde 1992, Hyde et al. 2000, Hyde & Fröhlich 2003, McKenzie et al. 2004, Ho et al. 2005, Pinruan et al. 2004, 2010a,b, Pinnoi et al. 2010, Liu et al. 2010). Their integration of phylogenetic methods with ecological studies catalyzed advancements in host-specificity and evolutionary classifications. Building upon these advances, S. Konta, D.S. Pereira, S.N. Zhang, Y.R. Xiong, and O. Karimi further expanded the taxonomic classification of palm fungi through integrative approaches combining multi-locus phylogenetics and ecological trait analysis, highlighting the critical role of this field in understanding fungal contributions to decomposition processes in tropical ecosystems (Konta et al. 2016b, Pereira & Phillips 2020, Zhang et al. 2020, Xiong et al. 2022a,b,2023, Karimi et al. 2024).
Fungal pathogens affecting Arecaceae species remain significant due to their economic impacts (Mendes et al. 2019, Hassan et al. 2021), yet are less well-documented than saprobes. There are an increasing number of reports of palm diseases caused by fungi, including Fusarium (Elliott 2011, Hernández-Hernández et al. 2010), Graphiola phoenicis (Mendes et al. 2019, Hassan et al. 2021), Marasmiellus (Jackson and McKenzie 1988), Palmeiromyces (Pereira & Phillips 2020), Pestalotiopsis (Xiong et al. 2022a), Phyllachora (Hyde & Cannon 1999, Bhunjun et al. 2022), Pseudopestalotiopsis (Tao et al. 2021), Serenomyces (Elliott & Des Jardin 2014) and Thielaviopsis (Klotz & Fawcett 1932). These cases highlight the ecological and agricultural importance of these pathogens.
Research on palm endophytic fungi emerged later, with the first documented study not appearing until 1990 (Rodrigues & Samuels 1990). Rodrigues (1994) subsequently elucidated colonization dynamics of endophytes in Euterpe oleracea, demonstrating positive correlations with leaf age, developmental stage, geographic location, and seasonal variation. Fröhlich et al. (2000) further revealed endophytic assemblages across distinct leaf tissues and aged organs of Licuala ramsayi. Taylor et al. (1999) provided insights into climatic drivers shaping endophytic community structures. Rungjindamai et al. (2008) and Pinruan et al. (2010a) characterized basidiomycetous endophyte diversity in foliar, rachis, and petiole tissues of Elaeis guineensis through integrated morphological and molecular analyses. Mahmoud et al. (2017) delineated root-associated endophytic diversity in coastal dune-inhabiting Phoenix dactylifera, highlighting strains with potential as biocontrol agents against root pathogens. Azuddin et al. (2021) profiled spine-associated endophytes of Calamus castaneu and evaluated their antagonistic activity against phytopathogens, while Dhillon et al. (2024) identified antagonistic endophytic consortia from Butyagrus nabonnandii foliage with efficacy against lethal palm pathogens. Bhunjun et al. (2024) postulated that most ascomycetes have endophytic ancestors, a hypothesis supported by saprobic palm fungi, such as Oxydothis (Konta et al. 2016b). Although palm endophyte research began later than other mycological studies, the recent molecular era, has brought it on par with broader fungal research. These advances now allow researchers to examine host-microbe interactions at a more precise level than ever before.
Pereira & Phillips (2023a) and Xiong et al. (2024) split palm mycological research into three distinct phases. The documented diversity of palm fungi has expanded. Pereira & Phillips (2023a) proposed a global estimate exceeding 2,500 fungal taxonomic species linked to palms, contrasting with Zhang et al. (2024) conservative tally of approximately 1,050 formally described species. Xiong et al. (2024) further quantify 1,625 occurrence records spanning 755 genera and 284 families within Ascomycota alone. Earlier analyses by Hyde (1997) suggested that Ascomycota and mitosporic (asexual) fungi constituted approximately 41% and 42% of palm-associated taxa, respectively. However, Pereira & Phillips (2023a) predicted a revised taxonomic distribution of approximately 55% Ascomycota, 35% asexual fungi, and 10% Basidiomycota. Significantly, Xiong et al. (2024) noted that historical diversity assessments may be biased by fragmented sampling regimes and taxonomic inconsistencies. Collectively, these findings underscore substantial unrealized diversity within palm-fungus systems, encompassing saprotrophic and pathogenic guilds, alongside endophytic lineages, while indicate the need for unified taxonomic frameworks to address ambiguities and accelerate discovery (Wanasinghe et al. 2018).
Additionally, Pereira & Phillips (2023a) noted that palm fungi exhibit rich biodiversity and complex community structures, making them excellent subjects for studying the organization and roles of fungal communities in ecosystems. These suggestions were primarily based on the work of Fröhlich & Hyde (1999), who identified palms as a significant substrate for studying fungal diversity because their fungal communities are extremely diverse. Taylor et al. (1996) also suggested that fungi found on palms are suitable candidates for research on fungal host-specificity and biogeography. (Zhou & Hyde 2001). Hyde (2001) catalogued multiple fungal taxa restricted to Archontophoenix alexandrae and allied palm genera, while Fröhlich & Hyde (1999) demonstrated 88% species-level dissimilarity between fungal communities of Licuala species from the same area. Yanna et al. (2001) also documented 6–17% fungal overlap within conspecific palm populations. The criteria for host-specificity are conventionally based on pathogenic fungi (Shivas & Hyde 1997). However, most fungi associated with palm trees are not pathogenic (Li et al. 2020). To accurately characterize the specificity of fungi occurring on palms, Zhou and Hyde (2001) proposed that palm fungi may show host-recurrence, meaning they recur on the same host but are rare or rarely present on neighboring hosts of the same family.
Hawksworth (2012) highlighted the limitations of scattered analyses and advocated establishing a continuous, unified reference dataset to further improve diversity assessments. The number of fungi is however, not settled and Hyde et al. (2024b) discussed ways in which research should be carried out to achieve better estimates. Hyde (1997, 2001) established a checklist of palm fungi, laying an important foundation for standardizing the recording of palm fungi. McKenzie et al. (2004) used the same approach to provide a fungal inventory for nikau palm (Rhopalostylis spp.) in New Zealand. In addition, Xiong et al. (2024) established a global data collection platform for palm fungi. However, Xiong et al. (2024) identified inconsistent records and data fragmentation as major impediments to assessments of palm fungal biodiversity and investigations into host-specificity. Thus, it is necessary to develop an updated checklist to more accurately predict the total number of palm fungi based on plant-fungus ratio. Pereira & Phillips (2023a) estimated that approximately 76,000 species of palm fungi exist, an estimate from applying the average plant-fungus ratio. However, a comprehensive characterization of palm fungal diversity cannot be achieved through the analysis of the horizontal relationship of plant-fungus ratios. Longitudinal data, compiled in chronological order, are required for studying fungal diversity and for guiding targeted exploratory work (Hawksworth & Lücking 2017).
The present study aims to: 1) provide morphological descriptions and illustrations of saprobic palm fungi, mainly collected in southern China and southern Thailand; 2) provide an updated estimate of palm fungi diversity; and 3) provide new insights into the palm-fungal host associations. Multi-gene phylogenetic analysis and morphological comparison were used to determine the collected fungal species and their taxonomic positions. Based on our collections and data from the USDA Systematic Mycology and Microbiology Laboratory (SMML) database (Farr & Rossman 2021) and screening of relevant literature from 1990 onwards, we compiled a time-space-host distribution record of palm-associated fungi. Based on this data, we predict the latest range of palm fungi diversity. In addition, three new definitions of host preference for palm fungi are also provided.
| Gene1 | Primer | Sequence (5’-3’) | Reference |
| ITS | ITS5 | GGAAGTAAAAGTCGTAACAAGG | White et al. (1990) |
| ITS4 | TCCTCCGCTTATTGATATGC | ||
| LSU | LR0R | ACCCGCTGAACTTAAGC | Vilgalys & Hester (1990) |
| LR5 | TCCTGAGGGAAACTTCG | ||
| SSU | NS1 | GTAGTCATATGCTTGTCTC | White et al. (1990) |
| NS4 | CTTCCGTCAATTCCTTTAAG | ||
| tef1-α | EF1-983F | GCYCCYGGHCAYCGTGAYTTYAT | Carbone & Kohn (1999) |
| EF1-2218R | TACTTGAAGGAACCCTTACC | ||
| tub2 | T1 | AACATGCGTGAGATTGTAAGT | Glass & Donaldson (1995) |
| Bt2b | CCRGAYTGRCCRAARACRAAGTTGTC | ||
| rpb2 | fRPB2-5F | GAYGAYMGWGATCAYTTYGG | O’Donnell et al. (2007) |
| fRPB2-7CR | CCCATRGCTTGYTTRCCCAT |
1 ITS: internal transcribed spacer; LSU: large subunit nuclear rRNA gene; SSU: small subunit nuclear rRNA gene; tef1-α: partial translation elongation factor 1-alpha gene; tub2: β-tubulin; rpb2: RNA polymerase II second largest subunit gene.
Materials and methods
Sampling Collection, Examination, and Isolation
Decaying palm tissues were collected from 2021 to 2025 in Guangxi Province (Guilin City), Jiangxi Province (Ganzhou, Nanchang, Pingxiang City), Yunnan Province (Kunming, Qujing, Xishuangbanna City), China and Narathiwat Province (Mueang Narathiwat District), Thailand. Specimens were sent to the Mycology Laboratories at Zhongkai University of Agriculture and Engineering, Guangdong Province, China, and Mae Fah Luang University, Chiang Rai, Thailand, for examination. Samples in good condition were selected according to the procedure described by Senanayake et al. (2020) for morphological observation and single spore isolation. Pure cultures were obtained from 80 fungal isolates and used for subsequent analyses. A Cnoptec SZ650 series (Cnoptec, China) stereomicroscope was used to observe macroscopic morphological characteristics, and photographs were taken using a SteReo Discovery V20. A Nikon Eclipse 80i and an industrial Digital Sight DS-Fi1 (Panasonic, Japan) microscope and imaging system were used to capture images of micromorphological characters. The measured data were processed using Tarosoft (R) Image Frame Work v.0.9.7, and photo plates were prepared using Adobe Photoshop 2023. Pure cultures are deposited in Zhongkai University of Agriculture and Engineering (ZHKUCC) or the Fungus Culture Collection Center of Mae Fah Luang University (MFLUCC), Chiang Rai, Thailand. Specimens are deposited in the Fungal Herbarium of Zhongkai University of Agriculture and Engineering (MHZU) or the Herbarium of Mae Fah Luang University (MFLU), Chiang Rai, Thailand. Faces of Fungi (FoF) numbers and Index Fungorum (IF) numbers were obtained (Jayasiri et al. 2015). All taxonomic information has been deposited in the Palm Fungi Database (Xiong et al. 2024).
DNA extraction, PCR amplification and sequencing
Pure cultures were grown on potato dextrose agar (PDA) plates for 2 weeks and approximately 500 mg of fresh fungal mycelia were scraped off. Total genomic DNA was extracted from mycelia using the MagPure Plant AS Kit (Magen Biotech, China) according to the manufacturer’s instructions. The total volume of the polymerase chain reaction (PCR) was 25 μl, which contained 12.5 μl 2xMaster Mix, 1 μl of each primer (10 pM) (forward and reverse), 2 μl genomic DNA template, and 8.5 μl ddH2O. The PCR thermal cycle program and primers are shown in Table 1. The PCR procedure was as follows: for ITS/LSU/SSU, the initial denaturation step was performed at 95 °C for 2 minutes, then 35 amplification cycles at 95 °C for 1 minute, 50 °C for 1 minute and 72 °C for 1 minute. Finally, extension for 10 minutes at 72 °C. For tef1-α/tub2, an initial step of 2 minutes at 95 °C followed by 35 cycles of 1 minute at 95 °C, 1 minute at 52 °C, 1 minute at 72 °C and 7 minutes at 72 °C. For rpb2 PCR conditions, an initial denaturation step was per formed at 95 °C for 5 minutes and then 30 cycles at 94 °C for 1 minute, 53 °C for 30 seconds, 72 °C for 90 seconds and finally 72 °C for 10 minutes. After PCR amplification, the product was observed on a 1% agarose gel under ultraviolet light. DNA sequencing was performed by Guangzhou Tianyi Technology Co. The new sequences have been deposited in GenBank.
Phylogenetic analyses
Weighted data processing methods
We first used the data from the USDA Systematic Mycology and Microbiology Laboratory (SMML) database, along with the preliminary screening of relevant peer-reviewed literature, and found that palm fungal data after 1990 are relatively complete mostly with photographic plates and molecular data. Thus, we used 1990 to 2025 as the time frame and obtained data from the US National Fungus Collections Fungus–Host Database (Farr et al. 2021) and Index Fungorum (http://www.indexfungorum.org/Names/Names.asp) We also examined palm-associated fungal studies published between 1990 and 2025. Only records containing “Name of Fungus”, “Current Name”, “Host”, “Location”, and “Year of Publication” was retained. If entries appeared duplicated, then we consulted the corresponding articles thus retaining only the first records for each fungal species at each location and host. All the data were summarized and sorted to obtain a checklist (Supplementary Table 1).
| Macro‑climate zone | Included subtypes (full name and code) | Grouping logic |
| Tropical | Tropical rainforest climate (Af), Tropical monsoon climate (Am), Tropical savanna climate (Aw) | All Group A subtypes: year-round high temperatures; variation in precipitation between monsoon/wet seasons. |
| Arid | Hot desert climate (BWh), Cold desert climate (BWk), Hot semi-arid climate (BSh), Cold semi-arid climate (BSk) | All Group B subtypes: potential evapotranspiration exceeds precipitation; differentiated into hot vs. cold deserts and steppes. |
| Subtropical | Hotsummer Mediterranean climate (Csa), Warmsummer Mediterranean climate (Csb), Coldsummer Mediterranean climate (Csc), Monsooninfluenced humid subtropical climate (Cwa), Subtropical highland climate with dry winters (Cwb), Cold subtropical highland climate (Cwc) | Selected Group C subtypes in midlatitudes: Mediterranean (summerdry) and monsoon/drywinter highland variants. |
| Temperate | Humid subtropical climate (Cfa), Temperate oceanic climate (Cfb), Subpolar oceanic climate (Cfc), Hotsummer continental Mediterranean climate (Dsa), Warmsummer continental Mediterranean climate (Dsb), Subarctic climate with dry, cold summers (Dsc), Subarctic climate with severe dry winters (Dsd), Monsooninfluenced hotsummer humid continental climate (Dwa), Monsooninfluenced warmsummer humid continental climate (Dwb), Monsooninfluenced subarctic climate (Dwc) | Remaining Group C subtypes plus Group D “summerdry”/”summerwet” variants in the warmer Drange. |
| Subarctic | Monsooninfluenced extremely cold subarctic climate (Dwd), Hotsummer humid continental climate (Dfa), Warmsummer humid continental climate (Dfb), Subarctic climate (Dfc) | Colder Dgroup subtypes: coldest month well below 0 ℃, with mild to short summers. |
| Polar | Extremely cold subarctic climate (Dfd), Tundra climate (ET), Ice cap climate (EF) | Dfd plus all Group E subtypes: all months average below 10 ℃ (tundra) or 0 ℃ (ice cap), unsuitable for trees. |
Climate classification is based on the Köppen-Geiger diagram provided by Beck et al. (2018), following the U.S. Department of Energy (2014) merging method. The detailed classification is shown in Table 2. The proportions of land area and climate zones were generated and exported using Google Earth Engine (Gorelick et al. 2017). Based on the PyCharm environment (Van Horn & Nguyen 2023), the Python programming language (Van Rossum & Drake 1995) was used to perform the corresponding local outlier factor (LOF) test (Breunig et al. 2000), Kolmogorov-Smirnov (KS) test (Massey 1951), negative binomial generalized linear model (GLM) (Hilbe 2011, Lord et al. 2012), mixed effect test (Zuur et al. 2009), and Monte Carlo simulation (Mooney 1997). RAWGraphs 2.0 (Mauri et al. 2017) was used to draw the analysis graphs.
Weight system construction
Time compensation weights are proposed based on palm fungal records and palm host species growth trends over time (Fig. 1):
: Indicates the time since the first record for each climate zone.
Based on the results of Fig. 2, palm fungal records are unevenly distributed in different countries and regions. In order to quantify the original data, this study uses climate distribution instead of national distribution and uses space-climate to weight and quantify the original data. The final spatial-climate weight formula is unevenly distributed in terms of number and country area:
: Total area of each climate zone in the sample country.
: Total area of the sample country.
: Total area of each climatic zone in all sample countries.
: Total area of all sample countries.
: The number of observations available in the partition.
: Total “climate weight” for all climate zones.
To adjust the discreteness of weighted data and make the data usable for subsequent analysis, we proposed the data discrete adjustment formula:
: Discrete adjustment function, the penalty model is , and the reward model is .
Parameter optimization via grid search yielded: α = 0.6, β = 0.3, γ = 0.1.
Triple Integration Weights
Considering the weights of spatial and temporal conditions and the discreteness of weighted data, we constructed a triple-integrated weight system. to correct the bias. Local outlier factor (LOF) detection with a neighborhood parameter k = 20 (determined by the elbow method) identified 137 outliers (2.25% of the total), which were excluded from subsequent analyses. Based on the Kolmogorov-Smirnov (KS) test, we found that the data distribution morphology was a typical non-normal distribution (P = 0).
To fully account for spatial dispersion, a temporal compensation model was proposed to fit the spatially discrete reward/penalty contrast. A negative binomial generalized linear model (GLM) with a logarithmic link function was used to validate the model, and the model fit was tested using mixed effects. The results showed satisfactory dispersion parameters (penalty model: 10.35; reward model: 11.58), confirming the appropriate treatment of overdispersion.
Weighted Mean Response Variable Prediction
The generalized linear model (GLM) framework was adopted to construct the response variable prediction equation based on the above two models with a logarithmic link function to predict the fungal diversity density under the corresponding model conditions:
The subarctic was used as the reference zone, and the optimal value, value and value of each climate were calculated by iterative weighted least squares (IRLS) based on the negative binomial distribution model (Table 3). Through Monte Carlo simulations (n=10,000 iterations), the prediction intervals (PI) generated by the two models (reward/penalty) cover 96.2% (reward) and 92.3% (penalty) of the holdout samples, respectively, demonstrating the robust generalization ability of the data and models.
Calculation of “plant: fungus” for palm fungi under the weight system
Based on the robust contrast model, we proposed the final weighted formula to fit the fungal record data worldwide to obtain the plant: fungus results.
: Number of palm species with fungal records in climate zone k.
: Total number of palm species with fungi recorded.
Table 3 The optimal value, value and value of each climate in this study.
| Model Type | Intercept | Climate Type | ||||||
|---|---|---|---|---|---|---|---|---|
| Tropical | Arid | Subtropical | Temperate | Subarctic | Polar | Extra | ||
| Dispersion Penalty | -1.1002 | 0.0196 | 1.7914 | 1.7609 | -0.6162 | 0.8749 | 0 | -1.6842 |
| Dispersion Reward | -0.6410 | 0.0121 | 1.8012 | 1.7600 | -0.5728 | 0.8527 | 0 | -1.6952 |
Results
Palm fungal diversity prediction
We collected 6,094 palm-associated fungal records from 1990 to 2025 and drew a three-dimensional trend chart of the total number of fungi and the annual growth of fungi-host-year (Fig. 1a, b). We also provide a multidimensional data bubble chart based on a country's major climate zones-total land area-national palm fungal records (Fig. 2). According to the trend in the three-dimensional graph, the number of fungal records and the number of recorded palm species have increased significantly over time (Fig. 1). Peaks in annual increase occurred in 1995, 2001, and 2003, primarily due to contributions from Hyde KD and colleagues (Fig. 1b). Based on the results of the multidimensional data bubble chart, we found that palm fungal records are unevenly distributed among 109 countries with different land areas, with a particular concentration in arid and tropical regions (Fig. 2).
To overcome these imbalanced records, in this study, we proposed a plant-fungus ratio based on the three-phase weighted processing of time-space-data discreteness. In addition, based on the results of the triple integral weight calculation, we used the data on climate zone area-climate zone fungal record weight-year to draw a waterfall chart of the triple integral weight distribution. The result shows an imbalance in fungal records across the six climate zones after data weighting, with greater representation in tropical and arid zones and less in subarctic and polar regions, consistent with the facts (Fig. 3). We then constructed an improved prediction method for the total amount of palm fungi diversity based on the final weighted formula .
Based on our weighted data and two discrete opposition models, the final fungus-plant ratio was determined using the final weighted formula. Based on the palm tree species baseline data (2558 accepted species) of Xiong et al. (2024), our model prediction results are shown in Table 4.
| Model Type | Plant: Fungi Ratio | Estimated Diversity (number) |
| Data dispersion penalty | 1:17.4 | 44,509 |
| Data dispersion reward | 1:28.2 | 72,136 |
Taxonomy
The taxa identified in this study are organized and classified according to the latest outline of fungi (Hyde et al. 2024a) and orders of Ascomycota (Thiyagaraja et al. 2025). The method of establishing new species was carried out according to the guidelines provided by Chethana et al. (2021), Jayawardena et al. (2021), Maharachchikumbura et al. (2021) and Manawasinghe et al. (2021). Based on multi-locus phylogenetic analyses and morphological characterization, this study describes and illustrates 98 taxa distributed across 66 genera, 50 families, 27 orders, and five classes in Ascomycota. The taxa illustrated below are arranged in alphabetical order.
Ascomycota Caval.-Sm.
Dothideomycetes sensu O.E. Erikss & Winka
Asterinales M.E. Barr ex D. Hawksw. & O.E. Erikss. (1986)
Stictographaceae D.Q. Dai & K.D. Hyde, Phytotaxa 369 (2): 70 (2018)
Proliferirostrum Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Index Fungorum number: IF 904904; Facesoffungi number: FoF 19207
Etymology: Refers to the “proliferations” conidiogenous cell and “rostrate” conidia of type species.
Type species: Proliferirostrum licualicola Y.R. Xiong, Manawas. & K.D. Hyde
Saprobic on dead substrates. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, hairy, velvety. Mycelium immersed in the substratum, branched. Conidiophores macronematous, mononematous, solitary, cylindrical, straight or slightly flexuous, significantly constricted with remnants of proliferation. Conidiogenous cells integrated, terminal, holoblastic, monoblastic, cylindrical, with percurrent proliferation. Conidia acrogenous, solitary, club-shape, short rostrate, tapering to the apex and rounded, truncate at the base, septate, guttulate, terminal cells pale, median cells dark. Sexual morph: Not observed.
Notes: Proliferirostrum is introduced here as a monotypic genus to accommodate type species Proliferirostrum licualicola. Based on our phylogenetic result (Fig. 4), Proliferirostrum formed an independent clade within Stictographaceae 97% ML bootstrap and 0.99 BYPP support. The phylogenetic results are similar to previous phylogenetic analyses on Asterinales by Hongsanan et al. (2020b), Tennakoon et al. (2021) and Marasinghe et al. (2022). However, molecular data are lacking for most species of Stictographaceae. Morphologically, Proliferirostrum is distinct from Stictographaceae, being hyphomycetous, in which conidia are rostrate and club-shaped, with conidiogenous cells having successive proliferations. However, Neoacrodictys is the only taxon reported as hyphomycetous in Stictographaceae, which is characterised by schizolytic conidial secession and conidia that have one longitudinal and a few transverse oblique septa, turbinate to obpyriform (Xia et al. 2022). Proliferirostrum has some characteristics similar to those of Sporidesmium, including holoblastic, cylindrical, conidiogenous cells and obpyriform or rostrate conidia (Yang et al. 2023b). However, Proliferirostrum has distinct monoblastic, conidiogenous cells with percurrent proliferation and acrogenous conidia with pale terminal cells and dark median cells. Because of these morphological differences and phylogenetic placement, we propose our collection as a new genus typified by Proliferirostrum licualicola.
Proliferirostrum licualicola Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 5
Index Fungorum number: IF 904905; Facesoffungi number: FoF 19208
Etymology: Refers to the host genus Licuala, from which the species was collected.
Saprobic on dead petiole of Licuala sp. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, hairy, velvety, dark brown to black. Mycelium immersed in the substratum, branched and brown with smooth hyphae. Conidiophores 50–140 × 5–6 μm (x̅ = 76.6 × 5.4 μm, n = 15), macronematous, mononematous, solitary, cylindrical, straight or slightly flexuous, constricted at remnants of proliferation, olivaceous to dark brown. Conidiogenous cells 7–9 × 4–5 μm (x̅ = 7.9 × 4.4 μm, n = 25), integrated, terminal, holoblastic, monoblastic, cylindrical, pale olivaceous, with percurrent proliferation. Conidia 25–35 × 8.5–9.5 μm (x̅ = 29.6 × 8.9 μm, n = 25), acrogenous, solitary, dry, club-shape, short rostrate, tapering to the rounded apex, truncate at the base, 4–6-septate, guttulate, terminal cells hyaline to pale olivaceous, median cells dark olivaceous. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA reaching 4 cm diam. after 2 weeks at 25 °C, circular, raised, brown, mycelium velvety, margin filiform, pale brown; reverse black to dark brown.
Known distribution: Thailand (this study).
Material examined: Thailand, Narathiwat Province, Toh Daeng Peat Swamp Forest, on dead petiole of Licuala sp., 4 Aug 2023, Y.R. Xiong and L. Lu, XG353 (MFLU 25-0156, holotype); ex-type MFLUCC 25-0222, other ex-type living culture MFLUCC 25-0223.
GenBank numbers: MFLUCC 25-0222: ITS – PV578230, LSU – PV578396, SSU – PV578534, tef1-α – PV608880, rpb2 – PV595350; MFLUCC 25-0223: ITS – PV578231, LSU – PV578397, SSU – PV578535, tef1-α – PV608881, rpb2 – PV595351.
Notes: Two collections from this study formed a separate lineage in the phylogenetic tree (Fig. 4). Based on a MegaBLAST (Query cover ≥ 70%) search using the ITS sequence, the closest matches in NCBIs GenBank nucleotide database were Neolinocarpon rachidis (GenBank MK120273; similarity 452/540 (83.70%), 26 gaps), Dothideomycetes sp. (GenBank OR658706; similarity 421/501 (84.03%), 15 gaps) and Dothideomycetes sp. (GenBank AB986427; similarity 425/505 (84.16%), 23 gaps). The highest similarities using the LSU sequence data were Rhizodiscina sp. (GenBank PQ608030; similarity 808/843 (95.85%), 2 gaps), Dothideomycetes sp. (GenBank AB986427; similarity 800/835 (95.81%), 2 gaps) and Rhizodiscina lignyota (GenBank OP763385; similarity 791/826 (95.76%), 2 gaps). The highest similarities using the SSU sequence data were Actinocladium aquaticum (GenBank NG_242859; similarity 986/1001 (98.50%), 1 gap), Morenoina palmicola (GenBank MK120299; similarity 1003/1020 (98.33%), 0 gap) and Rhizodiscina lignyota (GenBank MF599193; similarity 1001/1020 (98.14%), 0 gap). The highest similarities using the rpb2 sequence data were Morenoina rattanica (GenBank PP780229; similarity 860/1077 (79.85%), 0 gap). The highest similarities using the tef1-α sequence data were Helicosporium multidentatum (GenBank OR058863; similarity 818/897 (91.19%), 0 gap), Neohelicosporium guangxiense (GenBank MF535243; similarity 827/907 (91.18%), 1 gap) and Helicosporium flavum (GenBank KY873285; similarity 822/903 (91.03%), 0 gap). Proliferirostrum licualicola is distinct in its conidiophores being significantly constricted at the remnants of proliferation, conidiogenous cells with successive percurrent proliferations, 4–6-septate short rostrate conidia, tapering to the apex and rounded, truncate at base and terminal cells hyaline to pale olivaceous, three median cells dark olivaceous (Fig. 5). Based on the phylogenetic placement and morphological variations, we introduce P. licualicola as a new species.
Botryosphaeriales C.L. Schoch, Crous & Shoemaker, Mycologia 98 (6): 1050 (2007)
Botryosphaeriaceae Theiss. & P. Syd., Annales Mycologici 16 (1-2): 16 (1918)
Dothiorella Sacc., Michelia 2(6): 5 (1880)
Saccardo (1880) introduced Dothiorella with D. pyrenophora as the type species. However, Crous & Palm (1999) reduced it to synonymy under Diplodia. Phillips et al. (2005) reinstated Dothiorella as a separate genus based on morpho-molecular data of ITS and tef1-α and conidia being brown and 1-septate before they are discharged from the pycnidia. Based on phylogenetic results, Yang et al. (2017) proposed Spencermartinsia, which was introduced to accommodate Dothiorella-like species by Phillips et al. (2008), was not reliable in distinguishing from Dothiorella according to the morphological character of apiculate ascospores. Supported by further studies of morphology and phylogeny, Spencermartinsia was synonymized with Dothiorella (Hyde et al. 2019, Phookamsak et al. 2019). Dothiorella species are characterised by pigmented, 1-septate ascospores and conidia that become brown and 1-septate while they are attached to the conidiogenous cells (Phillips et al. 2005, Dissanayake et al. 2016). Phillips et al. (2005) used phylogenetic analysis combined ITS and tef1-α to resurrect Dothiorella. Subsequently, phylogenetic studies mainly use ITS, tef1-α and tub2 for analysis (Zhang et al. 2021, Li et al. 2023b, Lin et al. 2023, Wu et al. 2024). In this study, we use ITS, tub2 and tef1-α to update phylogenetic studies for Dothiorella. Currently, 334 epithets are listed under Dothiorella, and only 39 species have molecular data (Zhang et al. 2021, Li et al. 2023b, Hyde et al. 2024a, Index Fungorum 2025 July). Although four species (less than 2% of the species in this genus) have been reported on palms (Xiong et al. 2024, Supplementary Table 1), molecular data for three of these species are unavailable.
Dothiorella sarmentorum (Fr.) A.J.L. Phillips, J. Luque & A. Alves, Mycologia 97: 52. (2005). Fig. 7
Index Fungorum number: IF 501403; Facesoffungi number: FoF 02148
Sphaeria sarmentorum Fr., K. svenska Vetensk-Acad. Handl. 39: 107. (1818). Basionym.
≡ Diplodia sarmentorum (Fr.) Fr., Summ. veg. Scand. (Stockholm) 2: 417. (1849).
= Diplodia pruni Fuckel, Jahrb. Nassauischen Vereins Naturk., 23–24: 169. (1870) [1869].
= Botryosphaeria sarmentorum A.J.L. Phillips, J. Luque & A. Alves, Mycologia 97: 522. 2005.
Saprobic on dead petiole of Livistona chinensis. Asexual morph: Conidiomata 240–260 × 270–310 μm, stromatic, erumpent, forming split-like openings on the host, solitary or scattered in small groups, immersed, uni-loculate, black, with globose to subglobose. Peridium 25–40 μm, comprising several layers; outer layers thick-walled, dark brown cells of textura angularis; inner layers of thin-walled, lightly pigmented cells. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 12–16 × 3.5–6 μm (x̄ = 15 × 4.7 μm, n = 30), lining the pycnidial cavity, holoblastic, discrete, hyaline, subcylindrical, smooth, indeterminate, proliferating at the same level giving rise to periclinal thickenings. Conidia 18–23 × 9–13 μm (x̄ = 20 × 11 μm, n = 30), ellipsoid to obovoid, with a broadly rounded apex and truncate base, initially hyaline and aseptate becoming pigmented brown and 1-septate often while still attached to conidiogenous cell, brown walled, smooth-walled, slightly constricted at the septum. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA reaching 6 cm diam. after 2 weeks at 25 °C, raised with concave edge, circular, flat, filiform, grey.
Known distribution: worldwide (Zhang et al. 2021, Jayawardena et al. 2022, this study).
Material examined: China, Jiangxi Province, Nanchang City, road next to Meiling National Forest Park, on dead petiole of Livistona chinensis, 10 Apr 2024, Y.R. Xiong, XG423 (MHZU 24-0512, new host record), living culture ZHKUCC 25-0069, other living culture ZHKUCC 25-0070.
GenBank numbers: ZHKUCC 25-0069: ITS – PV578172, tub2 – PV584059; ZHKUCC 25-0070: ITS – PV578173, tef1-α – PV584060.
Notes: Two collections obtained in this study clustered with D. sarmentorum (= D. sempervirentis) by 97% ML and 0.99 BYPP bootstrap support (Fig. 6). Morphological evidence of conidiogenous cells and brown, 1-septate conidia fit well with D. sarmentorum (Phillips et al. 2005, Zhang et al. 2021, Fig. 7). Therefore, based on morphology and phylogenetic analysis, we identified our collection as a new record of D. sarmentorum. Dothiorella sarmentorum was formally recognized as a holomorphic species by Phillips et al. (2005). Zhang et al. (2021) synonymised nine species (D. californica, D. iberica, D. italica, D. guttulata, D. omnivora, D. parva, D. sempervirentis, D. symphoricarpicola, and D. vidmadera) under D. sarmentorum based on morphological evidence and phylogenetic analysis. This species has a wide range of hosts and geographic distribution worldwide (Zhang et al. 2021, Jayawardena et al. 2022, this study).
Neodeightonia C. Booth, Mycol. Pap. 119: 17 (1970) [1969]
Punithalingam (1969) introduced Neodeightonia with N. subglobosa as the type species. Later, Neodeightonia was synonymized with Botryosphaeria following the transfer of N. subglobosa to Botryosphaeria (Arx & Müller 1975). However, Phillips et al. (2008) recognized Neodeightonia as a separate genus by distinguishing it from Botryosphaeria based on morpho-molecular data. The sexual morph of Neodeightonia is characterized by hyaline, aseptate ascospores with bipolar germ pores, surrounded by a membrane that swells in water, acquiring a wing-like appearance. Asexually, they develop hyaline, aseptate conidia that may become pigmented, 1-septate and smooth to finely roughened or striate (Liu et al. 2012, Phillips et al. 2013, 2019). Phillips et al. (2008) used phylogenetic analysis of combined SSU, LSU, ITS, tub2 and tef1-α to identify Neodeightonia. Subsequently, phylogenetic studies mainly use SSU, LSU, ITS and tef1-α for species delination (Konta et al. 2016a, Wu et al. 2022, Xiong et al. 2022b). We used ITS, LSU, SSU and tef1-α to update phylogenetic analyses of Neodeightonia. Based on Pereira & Phillips (2023b) and Zhang et al. (2024), 11 species were listed in Neodeightonia, and all species have molecular data, which are also accepted in our study. Among these eight species (about 73% of the species in this genus), have been reported from palms (Supplementary Table 1), including a new host, Rhapis excelsa from China in this study.
Neodeightonia rattanicola Konta & K.D. Hyde, Mycosphere 7(7): 954 (2016) Fig. 9
Index Fungorum number: IF 552169; Facesoffungi number: FoF 02238
Saprobic on dead petiole of Rhapis excelsa. Asexual morph: Coelomycetous. Conidiomata stromatic 200–240 × 220–250 μm (x̅ = 220 × 240 μm, n = 10), pycnidial, semi-immersed, solitary, globose, unilocular, black dots, with a neck, papillate on the surface of the host where the conidiomata is located. Peridium 30–40 μm, composed of thick-walled, brown-black cells of textura angularis, thin inner wall with hyaline cells. Conidiogenous cell 15–25 × 5–10 μm (x̅ = 19 × 7.5 μm, n = 25), holoblastic, cylindrical to subcylindrical, hyaline. Conidia 20–25 × 10–12 μm (x̅ = 22 × 11 μm, n = 25), hyaline, unicellular, ellipsoid to obovoid, thick-walled, granulate, rounded at apex. Sexual morph: not observed.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 4–5 cm diam., at 25 °C, white at the edge, grey in the middle and outwardly strongly radiating. After 1 month of incubation, colonies on PDA, grey-olivaceous and spongy, hyphae, septate, branched and smooth.
Known distribution: China (this study), Thailand (Konta et al. 2016a).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on a dead petiole of Rhapis excelsa, 5 Feb 2023, Y.R. Xiong and L. Lu, XG224 (MHZU 24-0504, new host record), living culture ZHKUCC 25-0005, other living culture ZHKUCC 25-0006.
GenBank numbers: ZHKUCC 25-0005: ITS – PV578204; ZHKUCC 25-0006: ITS – PV578205.
Notes: Two collections obtained in this study clustered with Neodeightonia rattanicola (MFLUCC 15-0319) with 97% ML and 1.00 BYPP bootstrap support. The pairwise nucleotide differences (excluding gaps) between our collection and N. rattanicola (MFLUCC 15-0319) in ITS are 0.19% (1/513 base pairs). Morphological characters of conidiogenous cells and hyaline conidia are well fit with N. rattanicola (Konta et al. 2016a), although brown mature conidia were not observed in our collection. Based on morphology and phylogenetic analysis, we identified our collection as N. rattanicola. Neodeightonia rattanicola was described from decaying rachis of Calamus sp. from Thailand (Konta et al. 2016a), while Xiong et al. (2024) reported a new record on a dead petiole of Wodyetia bifurcate from China. Herein, we introduce a new record for N. rattanicola from Rhapis excelsa.
Phyllostictaceae Fr. (as ‘‘Phyllostictei’’), Summa vegetabilium Scandinaviae 2: 420 (1849)
Pseudofusicoccum Mohali, Slippers & M.J. Wingf., Stud. Mycol. 55: 249 (2006)
Crous et al. (2006) established Pseudofusicoccum with Ps. stromaticum as the type species after combining Fusicoccum stromaticum as Pseudofusicoccum stromaticum based on morphological evidence and phylogenetic analysis with LSU. Pseudofusicoccum was placed in Botryosphaeriaceae and distinct from Fusicoccum by conidia with a mucilaginous sheath and phylogeny (Crous et al. 2006). Although Yang et al. (2017) elevated Pseudofusicoccum to the familial rank as Pseudofusicoccaceae, the genus remains accepted within Phyllostictaceae, as phylogenetic analyses show it clusters between Phyllosticta and Neofusicoccum in Botryosphaeriales (Minnis et al. 2012, Slippers et al. 2013, Liu et al. 2017, Phillips et al. 2019). The asexual morph is characterized by corticolous, coriaceous, uni- to multilocular, immersed to erumpent pycnidial conidiomata, and hyaline, aseptate, cylindrical to ellipsoid conidia covered by a mucilaginous sheath (Crous et al. 2006, Senwanna et al. 2020). The sexual morph is characterized by scattered to clustered, uniloculate ascomata, bitunicate, cylindro-clavate asci with ocular chambers, and hyaline, uni to bi-seriate, aseptate, short clavate, smooth-walled ascospores with fine granules and surrounded by a mucilaginous sheath (Senwanna et al. 2020). Subsequently, phylogenetic studies used ITS and tef1-α (Mehl et al. 2011, Trakunyingcharoen et al. 2015, Jami et al. 2018, Tibpromma et al. 2018, Jayasiri et al. 2019), then added LSU or tub2 to the analysis (Senwanna et al. 2020, Li et al. 2023a, Hyde et al. 2024d). We used ITS, LSU, SSU, tub2 and tef1-α to update the phylogenetic tree for Pseudofusicoccum. Currently, nine epithets are listed under Pseudofusicoccum (Index Fungorum, 2025 July), with all species having molecular data. Two species (20% of the species in this genus) have been reported from palms, including the new species described in this study (Supplementary Table 1).
Pseudofusicoccum trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 11
Index Fungorum number: IF 904906; Facesoffungi number: FoF 19209
Etymology: Refers to the host genus Trachycarpus, from which the species was collected.
Saprobic on dead segment of Trachycarpus fortunei. Asexual morph: Coelomycetous. Colonies 230–290 × 120–150 μm (x̅ = 265 × 133 μm, n = 10) on natural substrate superficial, raising host surface and producing a dark brown area of dehiscence of pseudoclypeus, superficial to erumpent, solitary, gregarious, uni- to multi-loculate, immature functions as the locule for the mature conidiomata, black, short papillate, ostiolate. Ostioles central, papillate, periphysate. Peridium 20–50 μm wide, comprising several layers of heavily pigmented to hyaline, thick-walled, cells of textura epidermoidea, the exterior cells separate from the adjacent locules with cells become darker when locules mature. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 8–15 × 4–6 μm (x̅ = 11 × 4.6 μm, n = 25) blastic-sympodial, phialidic, formed from the innermost layer of pycnidial wall, hyaline, smooth-walled. Conidia 4–6 × 1.5–2.5 μm (x̅ = 4.8 × 2 μm, n = 25), hyaline, ellipsoid, occasionally slightly bent, apices rounded, smooth with fine granular content, unicellular, thin-walled. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 4 cm diam., at 25 °C, cream to grey cottony mycelium, regular margin, thin mycelium. Initially, reverse white and with age it becomes grey.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Nanchang City, road next to Meiling National Forest Park, on dead segment of Trachycarpus fortunei, 11 Apr 2024, Y.R. Xiong, XG430 (MHZU 24-0514, holotype); ex-type ZHKUCC 25-0077, other ex-type living culture ZHKUCC 25-0078.
GenBank numbers: ZHKUCC 25-0077: ITS – PV578240, LSU – PV578408, SSU – PV578542, tef1-α – PV608888, tub2 – PV584067; ZHKUCC 25-0078: ITS – PV578241, LSU – PV578409, SSU – PV578543, tef1-α – PV608889, tub2 – PV584068.
Notes: Two collections from this study formed a separate lineage and clustered with Pseudofusicoccum violaceum in the phylogenetic tree with 82% ML and 1.00 BYPP bootstrap support. The nucleotide differences (excluding gaps) between Ps. trachycarpi and Ps. violaceum were checked and given as follows, ITS: 0.72% (4/557 base pairs), tef1-α: 4.61% (15/326 base pairs) and tub2: 0.66% (3/452 base pairs). Pseudofusicoccum trachycarpi differs from Ps. violaceum by blastic-sympodial conidiogenous cells and smaller conidia (Ps. trachycarpi: x̅ = 4.8 × 2 μm vs Ps. violaceum: x̅ = 33 × 9.5 μm) (Mehl et al. 2011). Based on the phylogenetic placement and morphological variations, we introduce Ps. trachycarpi as a new species.
Hysteriales Lindau, Die Natürlichen Pflanzenfamilien nebst ihren Gattungen und wichtigeren Arten 1 (1): 265 (1897)
Hysteriaceae Chevall. [as ‘Hysterineae’], Fl. gén. env. Paris (Paris) 1: 432 (1826)
Gloniopsis De Not., G. bot. ital. 2(7–8): 12, 23 (1847)
De Notaris (1847) established Gloniopsis, without a designated type for the genus. Clements & Shear (1931) chose Gl. decipiens as the lectotype, following Höhnel (1918). Zogg (1962) regarded Gl. decipiens as a doubtful taxon and suggested Gl. praelonga as the type species. However, Gl. decipiens remains widely recognized as the type species (Boehm et al. 2009, Hyde et al. 2024c, Index Fungorum, 2025 July). Gloniopsis is characterised by hysterothecioid, globose to subglobose ascomata, cellular, hyaline, septate pseudoparaphyses, and ellipsoid, hyaline to yellowish ascospores with transverse septa and longitudinal septa surrounded by a gelatinous sheath or not (Boehm et al. 2009, Jayasiri et al. 2018). Based on morphological evidence and phylogenetic analysis of combined SSU, LSU, tef1-α, and rpb2 sequences, Boehm et al. (2009) placed Gloniopsis in Hysteriaceae. Subsequently, phylogenetic studies mainly use SSU, LSU, tef1-α and rpb2 or without SSU and rpb2 for analysis (Jayasiri et al. 2018, 2019, Valenzuela‐Lopez et al. 2019). The present study used ITS, LSU, and tef1-α to update phylogenetic analyses of Gloniopsis. Currently, 32 epithets are listed under Gloniopsis (Index Fungorum, 2025 July), but only three species (about 9% of the species in this genus) have molecular data. Three species have been reported from palms, including the new species described in this study (Supplementary Table 1).
Gloniopsis coryphae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 13
Index Fungorum number: IF 904907; Facesoffungi number: FoF 19210
Etymology: Refers to the host genus Corypha, from which the species was collected.
Saprobic on dead leaf sheath of Corypha umbraculifera. Asexual morph: Not observed. Sexual morph: Ascomata 150–230 × 160–220 μm (x̅ = 192.5 × 184 μm, n = 10), hysterothecia erumpent, erumpent to superficial, oval or ellipsoid to elongate, labiate, carbonaceous, scattered, dark, with a sunken longitudinal slit-like opening. Peridium 20–60 μm composed of brown and thick textura globulosa cells. Hamathecium pseudoparaphyses, hyaline, septate, branched, borne in a gelatinous matrix. Asci 60–70 × 15–20 μm (x̅ = 65 × 17 μm, n = 25), bitunicate, cylindrical to clavate, 8-spored, fissitunicate, apically rounded, short pedicellate, with sinuous stipe. Ascospores 16–20 × 8–9 μm (x̅ = 17.9 × 8.3 μm, n = 25), overlapping, bi-seriate, dictyosporous, asymmetric, 3–5 transverse and 1–2 vertical septa, fusiform, oblong or ellipsoidal, curved, constricted at the septa, smooth-walled, brown.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, dense, spongy, cream mycelium on the surface with entire margin; in reverse dark brown in the middle and brown at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead leaf sheath of Corypha umbraculifera, 5 Feb 2023, Y.R. Xiong and L. Lu, XG148 (MHZU 23-0132, holotype); ex-type ZHKUCC 24-0071, other ex-type living culture ZHKUCC 24-0072.
GenBank numbers: ZHKUCC 24-0071: ITS – PV578188, LSU – PV578352; ZHKUCC 24-0072: ITS – PV578189, LSU – PV578353.
Monoblastiales Lücking, M.P. Nelsen & K.D. Hyde, Fungal Diversity 63: 313 (2013)
Eriomycetaceae Huanraluek & Hyde, Fungal Diversity 100: 146 (2020)
Heleiosa Kohlm., Volkm.-Kohlm. & O.E. Erikss., Can. J. Bot. 74(11): 1830 (1996)
= Neoheleiosa Mortimer, Frontiers in Microbiology: 6 (2021)
Kohlmeyer et al. (1996) introduced Heleiosa with H. barbatula as the type species. Based on both ascospore morphological and phylogenetic evidence with combined LSU, ITS and SSU sequence data, Sun et al. (2025) synonymized Neoheleiosa under Heleiosa due to nomenclatural priority. Heleiosa has only been reported in sexual morph, which is characterized by ascomata that are solitary, scattered, immersed to erumpent, globose to subglobose or obpyriform, dark brown to black, and coriaceous. Asci are bitunicate, fissitunicate, cylindrical, pedicellate, with a rounded and thick-walled apex containing an ocular chamber. Ascospores are overlapping uniseriate, narrowly ovoid to clavate, 1-septate, hyaline when young, becoming dark brown at maturity, conically rounded at both ends, guttulate, thick-walled, faintly longitudinally striate, and having or lacking a mucilaginous sheath (Kohlmeyer et al. 1996, Mortimer et al. 2021). Zhang et al. (2023), based on morphological and phylogenetic analyses of combined LSU, SSU, ITS, and tef1-α, placed Heleiosa in Eriomycetaceae. Here, we used ITS, LSU, SSU and tef1-α to update the phylogenetic tree of Heleiosa (Fig. 14). Four epithets are listed under Heleiosa (Index Fungorum, 2025 July), and all species are associated with molecular data. Three species (75% of the species in this genus) have been reported from palms, including one new species and one new host record introduced in this study (Supplementary Table 1).
Heleiosa brunnea Y.R. Sun, Yong Wang bis & K.D. Hyde, Fungal Diversity 131: 127 (2025) Fig. 15
Index Fungorum number: IF 902586; Facesoffungi number: FoF 16412
Saprobic on dead segment of Livistona chinensis. Asexual morph: Not observed. Sexual morph: Ascomata 320–370 × 170–200 μm (x̅ = 340 × 188 μm, n = 5), immersed to erumpent, globose to subglobose or horizontally pyriform, coriaceous, ostiolate. Ostioles central or eccentric, with a minute papilla, periphysate, composed of thick-walled cells of textura intricata. Peridium 14–22 µm thick, hyaline to brown, contraction area becomes darker, textura intricata. Hamathecium comprises sparse, 1.5–3 µm wide, septate, branched pseudoparaphyses, intermixed with the asci, and embedded in matrix. Asci 90–125 × 9–13 μm (x̅ = 107 × 11.4 μm, n = 25), 8-spored, bitunicate, fissitunicate, cylindrical, pedicel furcate, rounded and thick-walled at the apex, ocular chamber. Ascospores 13–20 × 6–12 μm (x̅ = 16 × 8.5 μm, n = 25), uniseriate, ellipsoidal to narrowly ovoid or clavate, 1-septate, constricted at the septum, initially hyaline, becoming brown at maturity, guttulate, thick-walled, longitudinally striate, smooth-walled.
Culture characteristics: Colonies on PDA after 2 weeks reaching 35 mm diam., at 25 °C, circular, raised, cottony, producing mucus, glistening, white, reverse pastel yellow, with a yellowish-grey margin.
Known distribution: China (Sun et al. 2025, this study).
Material examined: China, Yunnan Province, Qujing City, Sanyuan District, on dead segment of Livistona chinensis, 29 Dec 2022, Y.R. Xiong and L. Lu, XG257 (MHZU 23-0183, new host record), living culture ZHKUCC 24-0173, other living culture ZHKUCC 24-0174.
GenBank numbers: ZHKUCC 24-0173: ITS – PV578206, LSU – PV578372, SSU – PV578516, tef1-α – PV608864; ZHKUCC 24-0174: ITS – PV578207, LSU – PV578373, SSU – PV578517, tef1-α – PV608865.
Notes: Two collections from this study clustered with Heleiosa brunnea in the phylogenetic tree with 100% ML and 1.00 BYPP bootstrap support (Fig. 14). The nucleotide differences (excluding gaps) between our collection and H. brunnea (HKAS 136883), were as follows: LSU: 0.02% (1/640 base pairs), ITS and SSU are 100% similar. Our collections morphologically consisted of H. brunnea from ascospore shape (Sun et al. 2025). Heleiosa brunnea was introduced on twigs of Osmanthus fragrans from China by Sun et al. (2025). Although ascospores from our collections are longitudinally striated, this was not observed by Sun et al. (2025). Based on the phylogenetic analysis, we identified our collection as a new host record of H. brunnea.
Heleiosa phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 16
Index Fungorum number: IF 904908; Facesoffungi number: FoF 19211
Etymology: Refers to the host genus Phoenix, from which the species was collected.
Saprobic on a dead segment of Phoenix canariensis. Asexual morph: Coelomycetous. Conidiomata 150–200 × 100–150 μm (x̅ = 170 × 125 μm, n = 10), pycnidial, semi-immersed, solitary, globose, unilocular, ostioles, papillate. Peridium 20–35 μm, composed of thick-walled, brown-black cells, textura angularis, inner wall with hyaline cells. Conidiophores reduce to conidiogenous cells. Conidiogenous cells 8–14(–25) × 2.5–4 μm (x̅ = 12.4 × 3.4 μm, n = 25), enteroblastic, phialidic to cylindrical, hyaline, smooth-walled, arising from stratum. Conidia 35–65 × 4–6.5 μm (x̅ = 60 × 5.4 μm, n = 25), clavate to elongate-acicular, slightly curved, truncate to rounded or acute apex, constricted at septa, 7–11(–12) septate, hyaline, 1–2 guttulate within the cell. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks, reaching 4 cm diam., at 25 °C, irregular growth, with fluffy, dense, white mycelium on the surface, grey at the edge, black base, reverse dark.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Qujing City, Sanyuan District, on dead sheath of Phoenix canariensis, 29 Dec 2022, Y.R. Xiong and L. Lu, XG116 (MHZU 23-0126, holotype); ex-type ZHKUCC 24-0059, other ex-type living culture ZHKUCC 24-0060.
GenBank numbers: ZHKUCC 24-0059: ITS – PV578208, LSU – PV578374, SSU – PV578518, tef1-α –PV608866; ZHKUCC 24-0060: ITS – PV578209, LSU – PV578375, SSU – PV578519, tef1-α – PV608867.
Notes: Two collections from this study formed a sister lineage with Heleiosa brunnea in the phylogenetic tree with 100% ML and 1.00 BYPP bootstrap support (Fig. 14). The nucleotide differences (excluding gaps) between H. phoenicis and H. brunnea were: ITS: 1.16% (6/518 base pairs), LSU: 1.12% (13/1158 base pairs), and tef1-α: 2.08% (20/960 base pairs). H. phoenicis represents the first reported asexual morph in Heleiosa. Based on phylogenetic placement and morphological variations, we introduce H. phoenicis as a new species.
Phellinocrescentia Crous & Decock, Persoonia 33: 235 (2014)
Crous et al. (2014b) introduced Phellinocrescentia with Ph. guianensis as the type species based on morphological evidence and combined ITS and LSU sequence data. Phellinocrescentia has been reported only from its asexual morph, which is characterized by conidiomata that are pycnidial, globose, solitary or aggregated, uni- to multilocular; the wall is composed of textura angularis, with the outer surface covered by warty hyphae. Conidia are aseptate, solitary, hyaline, smooth, guttulate, thin-walled, and ellipsoid to teardrop-shaped (Crous et al. 2014b). In this study, ITS, LSU, and tef1-α were employed to update phylogenetic analyses of Phellinocrescentia (Fig. 14). Only one epithet is listed in Index Fungorum (2025 July) with molecular data for Phellinocrescentia. Here, we describe a new species of Phellinocrescentia, which is the first report from palms (Supplementary Table 1).
Phellinocrescentia caryotae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 17
Index Fungorum number: IF 904909; Facesoffungi number: FoF 19212
Etymology: Refers to the host genus Caryota, from which the species was collected.
Saprobic on dead petiole of Caryota mitis. Asexual morph: Coelomycetous. Conidiomata 120–180 × 80–120 μm (x̅ = 151 × 98 μm, n = 10), pycnidial, separate, gregarious to confluent, globose to subglobose, semi-immersed, unilocular, ostiolate, thick-walled. Peridium 10–40 μm, composed of thick-walled, brown-black cells, textura epidermoidea, hyaline cell at base thin-walled. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 5–8 × 1.5–2.5 μm (x̅ = 6.4 × 1.9 μm, n = 25), hyaline, enteroblastic, phialidic, cylindrical, integrated, determinate, smooth-walled, periclinal wall thickened towards the apex. Conidia 2–3 × 1–1.5 μm (x̅ = 2.8 × 1.3 μm, n = 25), hyaline, elliptical, unicellular, smooth-walled, guttulate. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 35 mm diam., at 25 °C, circular, raised, producing mucus, glistening, pale creamy, reverse pastel yellow, with a yellowish-grey margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, an unidentified forest beside National Highway 219, on dead petiole of Caryota mitis, 5 Feb 2023, Y.R. Xiong and L. Lu, XG213 (MHZU 23-0164, holotype); ex-type ZHKUCC 24-0135, other ex-type living culture ZHKUCC 24-0136.
GenBank numbers: ZHKUCC 24-0135: ITS – PV578224, LSU – PV578390; ZHKUCC 24-0136: ITS – PV578225, LSU – PV578391.
Notes: Two collections from this study formed a separate lineage and clustered with Phellinocrescentia guianensis in the phylogenetic tree with 100% ML and 1.00 BYPP bootstrap support (Fig. 14). The nucleotide differences (excluding gaps) between Ph. caryotae and Ph. guianensis were checked and given as follows: ITS: 7.05% (38/539 base pairs), and LSU: 4.06% (36/886 base pairs). Morphologically, Ph. guianensis has brown, warty hyphae at the surface, whereas in Ph. caryotae this character was not observed (Crous et al. 2014b). Phellinocrescentia caryotae has a special structure with brown, thick-walled textura epidermoidea cells at the upper part and hyaline, thin-walled cells at the base. Based on the phylogenetic placement and morphological variations, we introduce Ph. caryotae as a new species.
Pleosporales Luttr. ex M.E. Barr (1987)
Aigialaceae Suetrong, Sakay., E.B.G. Jones, Kohlm., Volkm.-Kohlm. & C.L. Schoch, Studies in Mycology 64: 166 (2009)
Fissuroma J.K. Liu, Phook., E.B.G. Jones & K.D. Hyde, Fungal Diversity 51 (1): 145 (2011)
Liu et al. (2011) established Fissuroma with F. maculans as the type species. Fissuroma is a holomorphic genus, with the asexual morph known as pleurophomopsis-like coelomycetes. The sexual morph is characterized by hemispherical, black ascomata with a slit-like ostiole and flattened base, trabeculate pseudoparaphyses (Liew et al. 2000), obclavate to cylindrical asci, and ascospores which are fusiform, hyaline, 1-septate and surrounded by a distinctive sheath (Tanaka & Harada 2005, Liu et al. 2011, Phookamsak et al. 2015, Tennakoon et al. 2018). Liu et al. (2011) used morphological evidence and phylogenetic analysis of combined SSU and LSU sequence data to introduce Fissuroma as a new genus. Subsequently, phylogenetic studies mainly use SSU, LSU, ITS and tef1-α or without ITS for analysis (Phookamsak et al. 2015, Tennakoon et al. 2018, Wanasinghe et al. 2018, Zhang et al. 2020, Feng & Zhang 2022). Following Feng & Zhang (2022), we employed ITS, LSU, SSU and tef1-α to update the phylogenetic tree of Fissuroma (Fig. 18). Currently, 15 epithets are listed under Fissuroma (Index Fungorum, 2025 July), and 12 species are associated with molecular data. Among these nine species (60% of the species in this genus), have been reported from palms (Supplementary Table 1). This study introduces Fissuroma caryotae on Arenga tremula from China, which is a new host record.
Fissuroma caryotae Wanas., E.B.G. Jones & K.D. Hyde, Mycol. Progr. 17 (5): 579 (2018) Fig. 19
Index Fungorum number: IF 554088; Facesoffungi number: FoF 03608
Saprobic on dead rachis of Arenga tremula. Asexual morph: Not observed. Sexual morph: Ascomata 900–1100 × 250–370 μm (x̅ = 971 × 301 μm, n = 10), solitary, scattered, semi-immersed, immersed beneath host epidermis, appearing numerous, raised, dome-shaped areas on the host surface, conical, hemisphaerical, coriaceous, flattened at the base, unilocular, black, ostiolate. Ostioles carbonaceous slit-like opening, central. Peridium 30–100 μm wide, unequal thickness, poorly developed at the base, thick at sides towards the apex, base and corners comprising a mixture of host tissue and dark brown to hyaline fungal cells, black to dark brown, textura angularis to textura prismatica. Hamathecium 1–2 μm wide, composed of dense, hyaline, filiform, trabeculate, branched pseudoparaphyses, anastomosing among the asci. Asci 120–170 × 14–18 μm (x̅ = 141 × 17.4 μm, n = 30), 8-spored, bitunicate, fissitunicate, cylindric-clavate, or obclavate, short furcate pedicel, apically rounded with a truncate ocular chamber. Ascospores 45–50 × 10–13 μm (x̅ = 47.8 × 11.2 μm, n = 40), overlapping 1–2-seriate at the base, 1-seriate at the apex, fusiform, hyaline, smooth-walled, tapering to pointed apices, 1–3-septate, constricted at the medium septum, smooth-walled, with guttules, surrounded by a thin, distinctive sheath.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 2 cm diam., at 25 °C, medium dense, circular, tufted colony center elevated, surface slightly rough with white edge entire, velvety to hairy, white, greyish mycelium, becoming obverse grey to chestnut, reverse dark brown.
Known distribution: China (this study) and Thailand (Wanasinghe et al. 2018, Zhang et al. 2020).
Material examined: China, Yunnan Province, Xishuangbanna City, Xishuangbanna National Forest Park, on dead rachis of Arenga tremula, 4 Feb 2023, Y.R. Xiong and L. Lu, XG294 (MHZU 23-0193, new host record); living culture ZHKUCC 24-0193, other living culture ZHKUCC 24-0194.
Notes: Two collections obtained in this study clustered with Fissuroma caryotae by 76% ML bootstrap support and 1.00 BYPP value (Fig. 18). The nucleotide differences (excluding gaps) between our collection and F. caryotae (MFLU 17-1253) were calculated and given as follows; ITS: 1.83% (10/547 base pairs), LSU: 0.03% (3/829 base pairs), and tef1-α: 1.26% (11/871 base pairs). Although our collections have 1–3-septate ascospores, they are similar in size to F. caryotae (x̅ = 47.8 × 11.2 μm vs x̅ = 44.2 × 7.5 μm) as described in the type description (Wanasinghe et al. 2018). Therefore, based on morphology and phylogenetic analysis, we identified our collection as a new record of F. caryotae from Arenga tremula. Fissuroma caryotae was introduced on a dead trunk of Caryota urens from Thailand by Wanasinghe et al. (2018). Zhang et al. (2020) reported a new record on a dead petiole of Calamus sp. from Thailand.
Anteagloniaceae K.D. Hyde, Jian K. Liu & A. Mapook, Fungal Diversity 63: 33 (2013)
Anteaglonium Mugambi & Huhndorf, Syst. Biodiv. 7(4): 460 (2009)
Mugambi & Huhndorf (2009) established Anteaglonium to accommodate four species with An. abbreviatum (synonym of Glonium abbreviatum) as the type species based on phylogenetic analysis combined with LSU and tef1-α. Anteaglonium is a holomorphic genus with the asexual morph characterized by coelomycetous conidiomata, pseudoparenchymatous pycnidial walls, holoblastic conidiogenous cells and aseptate, globose, hyaline, guttulate conidia (Jaklitsch et al. 2018). The sexual morph is characterized by hysterothecial ascomata, carbonaceous navicular with a longitudinal slit, bitunicate, fissitunicate, cylindrical or clavate asci and septate, hyaline ascospores (Mugambi & Huhndorf 2009). Phylogenetic studies on Anteaglonium were mainly based on ITS, LSU, SSU, rpb2, and tef1-α, or on ITS and rpb2 alone for Dictyocheirospora, to delineate (Jayasiri et al. 2016b, 2019, Jaklitsch et al. 2018, Zhang et al. 2023). In this study, we used ITS, LSU, SSU, rpb2 and tef1-α to update phylogenetic analyses of Dictyocheirospora (Fig. 20). Currently, 11 epithets are listed under Dictyocheirospora (Index Fungorum, 2025 July), with all species having molecular data. Two species (about 18% of the species in this genus) have been reported from palms, including a new species we described (Supplementary Table 1).
Anteaglonium caryotae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 21
Index Fungorum number: IF 904910; Facesoffungi number: FoF 19213
Etymology: Refers to the host genus Caryota, from which the species was collected.
Saprobic on dead segment of Caryota mitis. Asexual morph: Not observed. Sexual morph: Hysterothecia 400–640 × 400–510 μm (x̅ = 494 × 445 μm, n = 10), superficial, solitary, scattered, globose to subglobose, black, carbonaceous, straight, slightly striate laterally, with a longitudinal slit, sulcus shallow. Peridium 40–150 μm wide, carbonaceous, brittle, thick, thickened towards apex, base thin, comprising pigmented cells of textural prismatica. Hamathecium 1–1.5 μm wide, comprising numerous, aseptate pseudoparaphyses, branched above the asci. Asci 60–80 × 8–10 μm (x̅ = 68 × 9.2 μm, n = 25), 8-spored, bitunicate, cylindrical, short pedicellate, club-shaped, apically rounded, obliquely to irregularly uniseriate. Ascospores 20–27 × 5–7 μm (x̅ = 23 × 5.9 μm, n = 25), biseriate, fusiform to obovoid, slightly curved, smooth-walled, 1–3-septate, 1-septate medium and constricted, upper cell frequently exhibits a septum, lower cell rarely has a septum, hyaline to pale brown, guttulate.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, white and flattened with immersed mycelium with entire margin; in reverse cream in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead leaf sheath of Caryota mitis, 5 Feb 2023, Y.R. Xiong and L. Lu, XG205 (MHZU 23-0160, holotype); ex-type ZHKUCC 24-0127, other ex-type living culture ZHKUCC 24-0128.
GenBank numbers: ZHKUCC 24-0127: ITS – PV578128, LSU – PV578298, SSU – PV578482, tef1-α – PV608812, rpb2 – PV595300; ZHKUCC 24-0128: ITS – PV578129, LSU – PV578299, SSU – PV578483, tef1-α – PV608813, rpb2 – PV595301.
Notes: Two collections from this study formed a separate lineage sister to Anteaglonium gordoniae in the phylogenetic tree with 100% ML bootstrap support and 1.00 BYPP value (Fig. 20). The nucleotide differences (excluding gaps) between our collection (ZHKUCC 24-0127) and An. gordoniae (MFLUCC 17-2431) were checked and given as follows: ITS: 3.94% (20/507 base pairs), LSU: 1.42% (12/844 base pairs), rpb2: 2.22% (24/1079 base pairs), and tef1-α: 3.43% (30/874 base pairs). Morphologically, An. caryotae has short pedicellate, club-shaped asci and peridium comprising pigmented cells of textural prismatica, which are different from An. gordoniae, comprising short pedicellate asci and peridium with pigmented textura angularis cells. Based on phylogenetic placement and morphological variations, we introduce An. caryotae as a new species.
Bambusicolaceae D.Q. Dai & K.D. Hyde, Fungal Diversity 63 (1): 49 (2013)
Corylicola Wijesinghe, Camporesi, Yong Wang bis & K.D. Hyde, Biodivers. Data J. 8: e55957, 7 (2020)
Corylicola was introduced by Wijesinghe et al. (2020) to accommodate the type species C. italica, isolated from dead branches of Corylus avellana (common hazel) in Italy. The genus is distinguished from other genera in Bambusicolaceae by the presence of yellowish-brown ascospore masses at the apex of the ascomatal neck (Wijesinghe et al. 2020). The sexual morph is characterized by globose to subglobose, ostiolate ascomata, cylindrical asci, and 1-septate ascospores (Wijesinghe et al. 2020, Zhang et al. 2023). The asexual morph is characterized by holoblastic, phialidic conidiogenous cells and aseptate conidia (Wijesinghe et al. 2020). We used ITS, LSU, SSU, rpb2 and tef1-α to update phylogenetic studies for Corylicola (Fig. 22). Corylicola comprises only three species, C. italica, C. hydei and C. coffeae (Index Fungorum, 2025 July) and all species are reported as saprobic from various plants and verified with DNA sequences (Wijesinghe et al. 2020, Zhang et al. 2023, Lu et al. 2025). Two species (about 66% of the species in this genus) have been reported from palms (Supplementary Table 1), including a new host record we introduce for Corylicola on Trachycarpus fortunei from China.
Corylicola coffeae L. Lu, K.D. Hyde & Tibpromma, Fungal Diversity, 135:532 (2025). Fig. 23
Index Fungorum number: IF 903608; Facesoffungi number: FoF 17562
Saprobic on dead segment of Trachycarpus fortunei. Asexual morph: Coelomycetous. Conidiomata 150–200 × 180–260 µm (x̅ = 179.8 × 217.5 µm, n = 20), pycnidial, immersed, solitary or aggregated, globose to subglobose, unilocular, dark brown to black, ostiolate. Ostioles central and circular. Conidiomata wall 15–20 µm (x̅ = 16.5 µm, n = 20), composed of several layers of hyaline to brown cells of textura angularis. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 4.5–6.5 × 2.5–4 µm (x̅ = 5.1 × 3.3 µm, n = 20), holoblastic, phialidic, ampulliform, hyaline, smooth-walled. Conidia 3–4.5 × 2–2.5 (x̅ = 3.8 × 2.3 µm, n = 20), solitary, subglobose or ovoid to ellipsoid, rounded or obtuse ends, hyaline to light brown, aseptate, guttulate, one-celled, smooth-walled. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 1–2 cm diam., at 25 °C, circular, flat, with filiform margin, dense, furry, whitish on upper surface and yellowish on the reverse of the colony.
Known distribution: China (Lu et al. 2025, this study).
Material examined: China, Jiangxi Province, Nanchang City, Meiling National Forest Park, on a dead segment of Trachycarpus fortunei, 11 April 2024, Y.R. Xiong, XG389 (MHZU 24-0511, new host record), living culture ZHKUCC 25-0047, other living culture ZHKUCC 25-0048.
GenBank numbers: ZHKUCC 25-0047: ITS – PV578156, LSU – PV578326, SSU – PV578494, tef1-α – PV608830, rpb2 – PV595312; ZHKUCC 25-0048: ITS – PV578157, LSU – PV578327, SSU – PV578495, tef1-α – PV608831, rpb2 – PV595313.
Notes: Two collections obtained in this study clustered with C. coffeae (MHZU 24-0568; ZHUKCC 21-1035 (ex-type); ZHUKCC 21-1036) by 85% ML bootstrap support and 1.00 BYPP value (Fig. 22). The nucleotide differences (excluding gaps) between our isolate (ZHKUCC 25-0047) and C. coffeae (ZHUKCC 21-1035) were checked and showed - ITS: 1.3% (7/501 base pairs), rpb2: 1.6% (18/1078 base pairs), and tef1-α: 0.3% (3/992 base pairs), while LSU and SSU are identical. Corylicola coffeae was introduced by Lu et al. (2025) as a sexual morph, whereas our collection is an asexual morph, making morphological comparison with the sexual morph of C. coffeae not feasible (Lu et al. 2025). However, our species exhibits characteristics consistent with the asexual morph of Corylicola species, particularly the presence of holoblastic, phialidic, and ampulliform conidiogenous cells, and hyaline, aseptate conidia (Wijesinghe et al. 2020, Fig. 23). Therefore, based on morphology and phylogenetic analysis, we identified our collection as a new host record and asexual morph for C. coffeae.
Dictyosporiaceae Boonmee & K.D. Hyde, Fungal Diversity 80: 462 (2016)
Dictyocheirospora M.J. D’souza, Boonmee & K.D. Hyde, Fungal Diversity 80: 465 (2016).
Boonmee et al. (2016) established Dictyocheirospora with Di. rotunda as the type species based on morphology, phylogenetic analysis of combined SSU, LSU, and tef1-α. Dictyocheirospora is a hyphomycetous genus and characterized by sporodochial conidiomata, dark-pigmented, micronematous or semi-macronematous conidiophores, and acrogenous, cheiroid, and coloured conidia (Boonmee et al. 2016, Tennakoon et al. 2023). Subsequently, phylogenetic studies mainly used SSU, LSU, ITS and tef1-α or without SSU for species delineation (Boonmee et al. 2016, Yang et al. 2018a, Shen et al. 2022, Tennakoon et al. 2023, Shu et al. 2024). In this study, we used ITS, LSU, and tef1-α to update phylogenetic analysis of Dictyocheirospora (Fig. 24). Currently, 31 epithets are listed under Dictyocheirospora (Index Fungorum, 2025 July), but only 24 species have molecular data. Among these six species (about 18% of the species in this genus), have been reported from palms, including the new host record described in this study (Supplementary Table 1).
Dictyocheirospora xishuiensis Y.R. Sun, Yong Wang bis & K.D. Hyde, Fungal Diversity 131: 141 (2025) Fig. 25
Index Fungorum number: IF 902591; Facesoffungi number: FoF 16420
Saprobic on dead segment of Elaeis guineensis. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, scattered. Mycelium immersed, composed of hyaline, smooth, septate, branched hyphae. Conidiomata sporodochial, dark brown to black. Conidiophores micronematous, undifferentiated from vegetative hyphae, short. Conidiogenous cells holoblastic, integrated, terminal, pale brown, smooth-walled. Conidia 27–43 × 14–19 μm (x̅ = 37 × 17 μm, n = 25), solitary, acrogenous, cheiroid, brown, arranged in 3–5 compact rows, with rows digitate, cylindrical, inwardly curved at apex, arising from a basal cell, with each row composed of 3–7 cells, euseptate, slightly constricted at septa, smooth-walled; with (1–)2(–3) rounded to cylindrical appendages, arising from two sides of conidial rows, grow toward both ends, hyaline. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface with entire margin; in reverse yellow in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on a dead segment of Elaeis guineensis, 5 Feb 2023, Y.R. Xiong and L. Lu, XG183 (MHZU 23-0151, new host record), living culture ZHKUCC 24-0109, other living culture ZHKUCC 24-0110.
GenBank numbers: ZHKUCC 24-0109: ITS – PV578162, LSU – PV578328, tef1-α – PV608834; ZHKUCC 24-0110: ITS – PV578163, LSU – PV578329, tef1-α – PV608835.
Notes: Two collections formed a sister lineage and clustered with Dictyocheirospora xishuiensis in the phylogenetic tree with 86% ML bootstrap support and 0.99 BYPP value. The nucleotide differences (excluding gaps) between our isolate (ZHKUCC 24-0109) and Di. xishuiensis (HKAS 136885) were checked and given as follows: ITS: 0.06
% (3/499 base pairs), and LSU 100%. Our collection is similar to Di. xishuiensis in conidial morphology (Sun et al. 2025). Based on phylogenetic placement and morphological variations, we introduce our isolate Di. xishuiensis. Dictyocheirospora xishuiensis was introduced by Sun et al. (2025) from dead twigs of Camphora sp. from China. To our knowledge, this is the first report of Di. xishuiensis from Elaeis guineensis.
Ganzhofusosporaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Index Fungorum number: IF 904911; Facesoffungi number: FoF 19214
Etymology: refers to the name of the type genus.
Type genus: Ganzhofusospora Y.R. Xiong, Manawas. & K.D. Hyde
Saprobic on dead substrates. Asexual morph: Not observed. Sexual morph: Ascogenous stromata immersed, pseudostromatic. Ascomata perithecium, semi-immersed, solitary, aggregated, globose to subglobose, setose. Setae brown, septate. Peridium dark brown to brown cells, normally arranged in textura angularis and textura prismatica. Hamathecium paraphyses, numerous, branched, anastomosing, multi-septate, hyaline, embedded in a gelatinous matrix. Asci 8-spored, bitunicate, cylindric to clavate, with a short-stalked, apically rounded, with ocular chamber. Ascospores overlapping, fusiform to cylindrical, septate, guttulate, with mucilaginous sheath.
Notes: Ganzhofusosporaceae is introduced to accommodate the new genus Ganzhofusospora, which formed a sister clade with Hermatomycetaceae and Pseudoberkleasmiaceae within Pleosporales (Fig. 26). Ganzhofusosporaceae shares the typical Pleosporales characters in having perithecioid ascomata with bitunicate and fissitunicate asci. However, Ganzhofusosporaceae differs from Hermatomycetaceae by having pseudostromatic ascomata with perithecium, multi-septate ascospores (de Silva et al. 2022a). Pseudoberkleasmiaceae has only a reported asexual morph; thus, we cannot compare (Tibpromma et al. 2018).
Ganzhofusospora Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Index Fungorum number: IF 904912; Facesoffungi number: FoF 19215
Etymology: Refers to the location Ganzhou, from where samples were collected and the “fusiform” shape of ascospores of the type species.
Type species: Ganzhofusospora phoenicis Y.R. Xiong, Manawas. & K.D. Hyde
Saprobic on dead substrates. Asexual morph: Not observed. Sexual morph: Ascogenous stromata immersed, pseudostromatic. Ascomata perithecium, semi-immersed, solitary, aggregated, globose to subglobose, dark, setose. Setae brown, septate. Peridium dark brown to brown, normally arranged in textura angularis and textura prismatica, heterogeneous compactness. Hamathecium paraphyses, numerous, branched, anastomosing, septate, and embedded in a gelatinous matrix. Asci 8-spored, bitunicate, cylindric-clavate, with a short-stalked, apically rounded, with a broadly ocular chamber when immature. Ascospores overlapping biseriate, fusiform to cylindrical, 1–5-septate, constricted at the medium septum, widest at the central cells, hyaline, guttulate, surrounded by a mucilaginous sheath.
Notes: Based on our phylogenetic results (Fig. 26), Ganzhofusospora forms a distinct clade within Pleosporales and is sister to Hermatomyces. Morphologically, Ganzhofusospora differs from Hermatomyces by having ascospores that are 1–5-septate, constricted at the median septum, widest at the central cells, and with a mucilaginous sheath (de Silva et al. 2022a). Pseudoberkleasmium has only been reported from its asexual morph (Tibpromma et al. 2018), and therefore, morphological comparison is not feasible. Based on morphological differences and phylogenetic results, we propose a monotypic genus, Ganzhofusospora, to accommodate the type species, G. phoenicis. More fresh collections of Ganzhofusospora are needed to stabilize the placement of this genus and the family Ganzhofusosporaceae. Only one species is known from palms (Supplementary Table 1).
Ganzhofusospora phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 27
Index Fungorum number: IF 904913; Facesoffungi number: FoF 19216
Etymology: Refers to the host genus Phoenix, from which the species was collected.
Saprobic on dead leaf sheath of Phoenix sylvestris. Asexual morph: Not observed. Sexual morph: Ascogenous stromata immersed, pseudostromatic. Ascomata 200–300 × 200–280 μm (x̅ = 255 × 230 μm, n = 10), perithecium, semi-immersed, solitary, aggregated, globose to subglobose, dark, uniloculate, erumpent black dot, coriaceous, setose. Setae brown, septate, straight or slightly curved. Peridium 30–55 μm, dark brown to brown cells of textura angularis and textura prismatica, heterogeneous, compact, part of slit-like, loosely arranged. Hamathecium 1.5–2.5 μm wide paraphyses, numerous, branched, anastomosing, septate, hyaline, embedded in a gelatinous matrix. Asci 115–190 × 20–25 μm (x̅ = 135 × 21 μm, n = 25) 8-spored, bitunicate, cylindric-clavate, with a short stalk, apically rounded, with broadly ocular chamber when immature. Ascospores 40–47 × 6–10 μm (x̅ = 43 × 8.5 μm, n = 40), overlapping biseriate, fusiform to cylindrical, 1–3-septate when immature, 5-septate when mature, constricted at the medium septum, widest at the central cells, hyaline, guttulate, surrounded by 1.5–3 μm mucilaginous sheath.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, circular, margin entire, dense, surface filamentous, cream at the margin, olivaceous in the center; reverse cream at the margin, dark olivaceous in the center.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Ganzhou City, Xingda Restaurant, on dead leaf sheath of Phoenix sylvestris, 9 Apr 2024, Y.R. Xiong, XG371 (MHZU 24-0458, holotype); ex-type ZHKUCC 25-0027, other ex-type living culture ZHKUCC 25-0028.
GenBank numbers: ZHKUCC 25-0027: ITS – PV578184, LSU – PV578348, SSU – PV578502, tef1-α – PV608852, rpb2 – PV595328; ZHKUCC 25-0028: ITS – PV578185, LSU – PV578349, SSU – PV578503, tef1-α – PV608853, rpb2 – PV595329
Notes: Two collections from this study formed a separate lineage in the phylogenetic tree with 98% ML and 1.00 BYPP bootstrap support (Fig. 26). Based on a MegaBLAST (Query cover ≥ 70%) search using the ITS sequence, the closest matches in NCBIs GenBank nucleotide database were Hermatomyces sphaericus (GenBank PP779923; similarity 419/455 (92.09%), 7 gaps), Hermatomyces sp. (GenBank LS398264; similarity 448/487 (91.99%), 10 gaps) and Hermatomyces constrictus (GenBank NR_191060; similarity 448/487 (91.99%), 10 gaps). The highest similarities using the LSU sequence were Hermatomyces jinghaensis (GenBank MW989519; similarity 863/896 (96.32%), 1 gap), Hermatomyces trangensis (GenBank KY790601; similarity 858/891 (96.30%), 0 gap) and Pseudoberkleasmium chiangmaiense (GenBank MZ420759; similarity 844/877 (96.24%), 1 gap). The highest similarities using the rpb2 sequence were Hermatomyces sphaericus (GenBank LS398358; similarity 439/517 (84.91%), 0 gap), Hermatomyces turbinatus (GenBank MZ042638; similarity 697/834 (83.57%), 4 gaps) and Hermatomyces amphisporus (GenBank LR812668; similarity 689/825 (83.52%), 4 gaps). The highest similarities using the tef1-α sequence were Anteaglonium gordoniae (GenBank MK360042; similarity 824/873 (94.39%), 2 gaps), Atrocalyx lignicola (GenBank LC194387; similarity 864/921 (93.81%), 0 gap) and Lophiotrema eburnoides (GenBank LC194403; Similarity 843/900 (93.67%), 2 gaps). Ganzhofusospora phoenicis is distinct by the heterogeneous compactness of its peridium, which is loosely arranged, and ascospores that are 1–3-septate when immature and 5-septate when mature. Based on phylogenetic placement and morphological variations, we introduce G. phoenicis as a new species.
Ganzhomycetaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Index Fungorum number: IF 904914; Facesoffungi number: FoF 19217
Etymology: refers to the name of the type genus.
Type genus: Ganzhomyces Y.R. Xiong, Manawas. & K.D. Hyde
Saprobic on dead substrates. Asexual morph: Coelomycetous. Conidiomata pycnidial, semi-immersed, solitary, oval to irregulate elliptical, unilocular, papillate. Peridium 20–35 μm, thick-walled, brown-black cells, textura angularis. Conidiophores reduced to conidiogenous cells. Conidiogenous cells enteroblastic, phialidic, cylindrical, smooth-walled. Conidia hyaline, spermatia, oblong or ellipsoidal, smooth-walled, guttulate. Sexual morph: Not observed.
Notes: Ganzhomycetaceae is introduced to accommodate the new genus Ganzhomyces, which formed an independent branch with Massariaceae and Neomassariaceae in Pleosporales (Fig. 26). Massariaceae have cylindrical to ampulliform conidiophore, which differs from Ganzhomycetaceae by conidiophores that are reduced to conidiogenous cells (Hongsanan et al. 2020a). However, Neomassariaceae has only been reported from its asexual morph (Yang et al. 2024); therefore, we cannot compare morphology with our collection.
Ganzhomyces Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Index Fungorum number: IF 904915; Facesoffungi number: FoF 19218
Etymology: Refers to the location, Ganzhou, where the specimen was collected and “fungus”.
Type species: Ganzhomyces phoenicis Y.R. Xiong, Manawas. & K.D. Hyde
Saprobic on dead substrates. Asexual morph: Coelomycetous. Conidiomata pycnidial, semi-immersed, solitary, oval to irregulate elliptical, unilocular. Peridium composed of thick-walled, brown-black cells, textura angularis. Conidiophores reduced to conidiogenous cells. Conidiogenous cells enteroblastic, phialidic, cylindrical, hyaline, smooth-walled, arising from stratum. Conidia hyaline, spermatia, oblong or ellipsoidal, unicellular, smooth-walled, with 1–2 small guttules. Sexual morph: Not observed.
Notes: Based on our phylogenetic result (Fig. 26), Ganzhomyces formed a distinct clade in Pleosporales. Morphologically, Ganzhomyces is characterised by enteroblastic and phialidic, cylindrical conidiogenous cells. According to morphological differences and phylogenetic results, we propose a monotypic genus Ganzhomyces to accommodate the type species Ga. phoenix. More fresh collections of Ganzhomyces are needed to stabilize the placement of this genus and the family Ganzhomycetaceae.
Ganzhomyces phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 28
Index Fungorum number: IF 904916; Facesoffungi number: FoF 19219
Etymology: Refers to the host genus Phoenix, from which the species was collected.
Saprobic on dead leaf sheath of Phoenix sylvestris. Asexual morph: Coelomycetous. Conidiomata 150–200 × 100–150 μm (x̅ = 170 × 125 μm, n = 10), pycnidial, semi-immersed, solitary, oval to irregulate elliptical, unilocular, distribute in fibrous bundle ridges with forming papillate. Peridium 20–30 μm, composed of thick-walled, brown-black cells, textura angularis. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 4–8 × 2–3 μm (x̅ = 5.4 × 2.2 μm, n = 25), enteroblastic, phialidic, cylindrical, hyaline, smooth-walled, arising from peridium inside cells. Conidia 2.5–4 × 1.5–2 μm (x̅ = 3.4 × 1.7 μm, n = 25), hyaline, spermatia, oblong or ellipsoidal, unicellular, smooth-walled, with 1–2 small guttules. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, circular, margin entire, dense, mycelium velvety towards the margin, cream; reverse cream at the margin, grey in the center.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Ganzhou City, Xingda Restaurant, on dead leaf sheath of Phoenix sylvestris, 9 Apr 2024, Y.R. Xiong, XG362 (MHZU 24-0456, holotype); ex-type ZHKUCC 25-0019, other ex-type living culture ZHKUCC 25-0020.
GenBank numbers: ZHKUCC 25-0019: ITS – PV578186, LSU – PV578350, SSU – PV578504, tef1-α – PV608854; ZHKUCC 25-0020: ITS – PV578187, LSU – PV578351, SSU – PV578505, tef1-α – PV608855.
Notes: Two collections from this study formed a separate lineage in Pleosporales phylogenetic tree with 98% ML and 1.00 BYPP bootstrap support (Fig. 26). Based on a MegaBLAST (query cover ≥ 70%) search using the ITS sequence, the closest matches in NCBIs GenBank nucleotide database were Lorrainsmithia elkeae (GenBank PQ066529; similarity 404/465 (86.88%), 16 gaps), Trichomerium syzygii (GenBank MN901487; similarity 405/466 (86.91%), 17 gaps) and Pseudocercospora sphaerellae-eugeniae (GenBank KC731558; similarity 402/466 (86.27%), 21 gaps). The highest similarities using the LSU sequence were Trichomerium syzygii (GenBank MN901474; similarity 785/813 (96.56%), 0 gap), Ascomycota sp. (GenBank MH323446; similarity 887/919 (96.52%), 3 gaps) and Lorrainsmithia elkeae (GenBank PQ060439; similarity 832/865 (96.18%), 1 gap). The highest similarities using the SSU sequence were Ophiosphaerella herpotricha (GenBank KC841054; similarity 1022/1051 (97.24%), 4 gaps), Neomassaria sp. (GenBank ON804892; similarity 1017/1046 (97.23%), 4 gaps) and Triseptatospora calami (GenBank NG_242833; similarity 1016/1047 (97.04%), 4 gaps). The highest similarities using the tef1-α sequence were Tamaricicola muriformis (GenBank KU600013; similarity 880/935 (94.12%), 0 gap), Bambusicola meishanensis (GenBank PQ278548; similarity 896/956 (93.72%), 1 gap) and Pyrenochaeta sp. (GenBank LT797110; Similarity 920/984 (93.50%), 1 gaps). Ganzhomyces phoenicis is distinguished by producing oval to irregular elliptical and unilocular conidiomata, and conidia that are unicellular and oblong or ellipsoidal. Based on phylogenetic placement and morphological variations, we introduce Ga. phoenicis as a new species.
Lophiotremataceae K. Hiray. & Kaz. Tanaka, Mycoscience 52: 405 (2011)
Atrocalyx A. Hashim. & Kaz. Tanaka, Persoonia 39: 59 (2017)
Atrocalyx trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 30
Index Fungorum number: IF 904917; Facesoffungi number: FoF 19220
Etymology: Refers to the host species Trachycarpus, from which the species was collected.
Saprobic on dead leaflet of Trachycarpus fortunei. Asexual morph: Not observed. Sexual morph: Ascomata 300–370 × 170–200 μm (x̅ = 343 × 183 μm, n = 10), multilocular, solitary, scattered, immersed, erumpent through host surface, sub-globose, ostiolate. Ostiolar neck 30–45 × 45–50 μm (x̅ = 39 × 47 μm, n = 10), dark, carbonaceous, fragile, with irregular opening, plugged by periphyses. Peridium 20–60 μm, composed of dark cells of textura angularis, inner layer of light pigmented to hyaline cells of textura angularis. Hamathecium 1.5–2.5 μm wide, dense, branched, septate, cylindrical pseudoparaphyses. Asci 65–100 × 9–13 μm (x̅ = 78 × 11 μm, n = 25), 8-spored, bitunicate, fissitunicate, cylindrical, with a short furcate pedicel, apically rounded with an ocular chamber. Ascospores 18–22 × 4.5–8 μm (x̅ = 20 × 6 μm, n = 25), biseriate, ellipsoidal to broadly fusiform, 1-septate, constricted at the septum, with distinct large guttules in each cell, surrounded by a thick mucilaginous sheath.
Culture characteristics: Colonies on PDA after 2 weeks reaching 3.5 cm diam., at 25 °C, colonies dense, circular, flattened, raised surface rough with crenate edge, velvety, colour of colonies in the upper part: dark grey at the margin light grey at the centre; reverse black at the margin dark grey at the centre.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Nanchang City, the road next to Meiling National Forest Park, on a dead leaflet of Trachycarpus fortunei, 11 Apr 2024, Y.R. Xiong, XG399 (MHZU 24-0463, holotype), ex-type ZHKUCC 25-0055, other ex-type living culture ZHKUCC 25-0056.
GenBank numbers: ZHKUCC 25-0055: ITS – PV578134, LSU – PV578304, tef1-α – PV608818, rpb2 – PV595306; ZHKUCC 25-0056: ITS – PV578135 LSU – PV578305, tef1-α – PV608819, rpb2 – PV595307.
Notes: Two collections from this study clustered in Atrocalyx clade in Lophiotremataceae and formed a sister lineage to A. guttulatus and A. krabiensis in the phylogenetic tree with 99% ML and 1.00 BYPP bootstrap support (Fig. 29). The nucleotide differences (excluding gaps) between A. trachycarpi and its phylogenetically related species were checked: A. guttulatus (MFLUCC 10-0929) - LSU: 0.23% (2/858 base pairs), and tef1-α: 5.14% (47/914 base pairs); A. krabiensis (MFLUCC 18-0237) - ITS: 5.86% (27/461 base pairs), LSU: 0.35% (3/870 base pairs), and tef1-α: 2.22% (20/900 base pairs). Atrocalyx trachycarpi differs from A. guttulatus and A. krabiensis by multilocular ascomata. Moreover, A. guttulatus is characterized by uniseriate ascospores with terminal appendages and is clearly distinguished from A. trachycarpi, which has biseriate ascospores surrounded by a thick mucilaginous sheath (Tibpromma et al. 2017). In addition, A. krabiensis, has 1–6-septate ascospores compared to the 1-septate ascospores of A. trachycarpi (Jayasiri et al. 2019). Based on phylogenetic placement and morphological variations, we introduce A. trachycarpi as a new species.
Lophiotrema Sacc., Michelia 1 (no. 3): 338 (1878)
Saccardo 1878 established Lophiotrema, and Chesters & Bell (1970) synonymized this genus with Lophiostoma, arguing that neither ascospore color nor the number of transverse septa provided a sufficient basis for generic distinction. However, Holm & Holm (1988) restored Lophiotrema based on cylindrical or oblong asci and a nearly equal thickness of the peridium, features of Lophiotrema, along with ascomata having a slit-like ostiole (Hirayama & Tanaka 2011, Hashimoto et al. 2017). Although a pycnidial asexual morph was reported in Pleurophomopsis, this connection has never been successfully demonstrated (Leuchtmann 1985, Zhang et al. 2009, Li et al. 2020). Zhang et al. (2009) updated the phylogenetic analysis using combined LSU, SSU, tef1-α, rpb1, and rpb2 sequences for Lophiotrema. Subsequently, phylogenetic studies mainly used LSU, ITS, SSU, tef1-α, rpb2 or only LSU and SSU for analysis (Tibpromma et al. 2017, Phookamsak et al. 2019, Li et al. 2023c), and this study employed ITS, LSU, rpb2 and tef1-α to update the phylogenetic tree of Lophiotrema (Fig. 31). Currently, 48 epithets are listed under Lophiotrema (Index Fungorum, 2025 July); however, only 12 species are associated with molecular data. Totally 10 species (about 38% of the species in this genus) have been reported from palms, including a new species described in this study (Supplementary Table 1).
Lophiotrema guineensis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 32
Index Fungorum number: IF 904918; Facesoffungi number: FoF 19221
Etymology: Refers to the host species Elaeis guineensis, from which the species was collected.
Saprobic on dead petiole of Elaeis guineensis. Asexual morph: Coelomycetous. Conidiomata 170–200 × 100–130 μm (x̅ = 182 × 112 μm, n = 10), pycnidial, immersed, solitary, coalescing, hemispherical or pyriform, unilocular, cracks epidermis of substrate. Peridium 15–25 μm, composed of thick-walled, brown cells, inner wall with hyaline cells, textura angularis. Conidiophores reduced to conidiogenous cells. Conidiogenous cell 2–5 × 1–2 μm (x̅ = 3.4 × 1.5 μm, n = 25), enteroblastic, phialidic to cylindrical, hyaline, smooth-walled, arising from stratum. Conidia 5–7 × 2–3 μm (x̅ = 6 × 2.3 μm, n = 25), spermatia, oblong to ellipsoid, slightly curved, truncate to rounded, aseptate, hyaline, 1–2 small guttule within the cell. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface with entire margin; in reverse yellow in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead petiole of Elaeis guineensis, 5 Feb 2023, Y.R. Xiong and L. Lu, XG175 (MHZU 24-0451, holotype), ex-type ZHKUCC 25-0001, other ex-type living culture ZHKUCC 25-0002.
GenBank numbers: ZHKUCC 25-0001: LSU – PV578362, tef1-α – PV608856; ZHKUCC 25-0002: LSU – PV578363, tef1-α – PV608857.
Notes: Two collections from this study formed an independent lineage within Lophiotrema in the phylogenetic tree with 70% ML bootstrap support and 1.00 BYPP (Fig. 31). Based on a MegaBLAST (Query cover ≥ 70%) search using the LSU sequence, the closest matches in NCBIs GenBank nucleotide database were L. neoarundinaria (GenBank OR253247; similarity 842/855 (98.48%), 0 gap), L. hydei (GenBank OR253264; similarity 840/853 (98.48%), 0 gap) and L. mucilaginosis (GenBank OQ771954; similarity 837/850 (98.47%), 0 gap). The highest similarities using the tef1-α sequence were Atrocalyx lignicola (GenBank GU349072; similarity 743/813 (91.39%), 1 gap), Cryptoclypeus ryukyuensis (GenBank LC194392; similarity 830/912 (91.01%), 2 gaps) and L. hydei (GenBank MK108984; similarity 838/924 (90.69%), 2 gaps). Morphologically, Lophiotrema guineensis fits well with Lophiotrema in asexual morph (Tanaka & Harada 2003). However, L. guineensis is distinct from Lophiotrema by its asexual morph, with oblong to ellipsoid, aseptate conidia. Based on phylogenetic placement and morphological variations, we introduce L. guineensis as a new species.
Melanommataceae G. Winter, Rabenh. Krypt. -Fl., Edn 2 (Leipzig) 1.2: 220 (1885)
Byssosphaeria Cooke, Grevillea 7(no. 43): 84 (1879)
Cooke (1879) introduced Byssosphaeria with B. keithii as the type species. Byssosphaeria was once synonymised with Herpotrichia (Bose 1961, Sivanesan 1971, Arx & Müller 1975) but was reinstated as a genus by Barr (1984) and later formally described (Barr 1990). Byssosphaeria species are usually reported as the sexual morph which is characterized by superficial, usually gregarious ascomata, with bright yellow, orange or red wide ostiole, and a subiculum of dense hyphae around the ascomata, with fusiform, hyaline to pale brown ascospores, surrounded by a mucilaginous sheath that is drawn out at both ends (Barr 1990, Tian et al. 2015). Mugambi & Huhndorf (2009) conducted a phylogenetic analysis of Byssosphaeria using combined LSU and tef1-α sequences, which supported its status as a distinct genus within Melanommataceae. Subsequent phylogenetic studies primarily used LSU, SSU, tef1-α, and, with or without, rpb2 or ITS for analysis (Hongsanan et al. 2020a, Yang et al. 2022, Kularathnage et al. 2022, Tennakoon et al. 2024, Zhang et al. 2024). We used ITS, LSU, SSU, and tef1-α to update phylogenetic analyses of Byssosphaeria (Fig. 33). Currently, 29 epithets are listed under Byssosphaeria (Index Fungorum, 2025 July), but only 15 species have molecular data. Five species (about 24% of the species in this genus) have been reported from palms, including a new species described in this study (Supplementary Table 1).
Byssosphaeria lataniicola Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 34
Index Fungorum number: IF 904919; Facesoffungi number: FoF 19222
Etymology: Refers to the host genus Latania, from which the species was collected.
Saprobic on dead segment of Latania verschaffeltii. Asexual morph: Not observed. Sexual morph: Ascomata 480–500 × 470–500 μm (x̄ = 493 × 484 μm, n = 10), perithecial, clusters on surface or semi-immersed, superficial, subglobose, dark brown, coriaceous, ostiolated canal, setae 5.7 µm wide. Peridium 60–95 µm wide, comprising two cell types, outer layer comprising thick brown textura prismatica cell layers, and inner composed of thin hyaline textura angularis cells to textura globosa. Hamathecium 2–3 μm wide, composed of dense, trabeculate (Liew et al. 2000), branched, anastomosing, pseudoparaphyses, embedded in a hyaline gelatinous matrix. Asci 120–150 × 13–16 μm (x̄ = 140 × 14.7 μm, n = 30), 8-spored, bitunicate, fissitunicate, cylindric-clavate, knob-like to furcated-like pedicel, apically rounded, with ocular chamber. Ascospores 30–35 × 7–9 μm (x̄ = 32 × 7.9 μm, n = 30), overlapping 1–2-seriate, fusiform with acute ends, hyaline to brown, 1–3-septate, straight to slightly curved, slightly constricted at septum, smooth-walled, guttulate, surrounded by a gelatinous sheath when hyaline, delicate, sometimes appearing as a wing-like expansion near the central septum.
Culture characteristics: Colonies on PDA reaching 28 mm diam. after 2 weeks at room 25 °C, circular, convex, effuse, velvety to fluffy, light orange to white from the above; yellowish-brown at the centre, yellowish brown to orange at the margin from the reverse.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead segment of Latania verschaffeltii, 5 Feb 2023, Y.R. Xiong and L. Lu, XG165 (MHZU 23-0144, holotype); ex-type ZHKUCC 24-0095, other ex-type living culture ZHKUCC 24-0096.
GenBank numbers: ZHKUCC 24-0095: ITS – PV578138, LSU – PV578308, SSU – PV578486, tef1-α – PV608820; ZHKUCC 24-0096: ITS – PV578139, LSU – PV578309, SSU – PV578487, tef1-α – PV608821.
Notes: Two collections from this study formed a separate lineage sister to Byssosphaeria jamaicana in the phylogenetic tree with 100% ML bootstrap support and 1.00 BYPP value (Fig. 33). The nucleotide differences (excluding gaps) between B. lataniicola and B. jamaicana were checked and given as follows: LSU: 2.04% (18/882 base pairs), and tef1-α: 1.92% (14/730 base pairs). Byssosphaeria lataniicola is characterized by 1–3-septate ascospores, which differ from the strongly constricted ascospores of B. jamaicana, which possess a single medium septum (Niranjan & Sarma 2019). In addition, ascospores of B. lataniicola have a gelatinous, hyaline sheath, which is absent in B. jamaicana (Niranjan & Sarma 2019). Based on phylogenetic placement and morphological variations, we introduce B. lataniicola as a new species.
Byssosphaeria musae Phookamsak & K.D. Hyde, Fungal Diversity 72: 119 (2015) Fig. 35
Index Fungorum number: IF 550932; Facesoffungi number: FoF 00436
Saprobic on dead segment of Borassus flabellifer. Asexual morph: Not observed. Sexual morph: Ascomata 400–450 × 370–400 μm (x̄ = 420 × 395 μm, n = 10), gregarious, scattered, superficial on subiculum, visible as dark spots on host, orange to yellow around pore, uni-loculate, globose to subglobose, setose, apex rounded, ostiole central, with pore-like opening, setae 5.5 µm wide. Peridium 60–100 μm wide, thick-walled, of equal thickness, composed of several layers of dark brown to black cells, arranged in textura angularis to textura prismatica. Hamathecium 1–2 μm wide, composed of dense, trabeculate, distinctly septate, anastomosing, pseudoparaphyses, embedded in a hyaline gelatinous matrix. Asci 75–135 × 10–15 μm (x̄ = 108 × 13.7 μm, n = 25), 8-spored, bitunicate, fissitunicate, clavate, long pedicellate with knob-like pedicel, apically rounded, with well-developed ocular chamber. Ascospores 30–35 ×5–8 μm (x̄ = 32 × 7 μm, n=30), overlapping 1–2-seriate, fusiform, with acute ends, hyaline to pale brown when young, becoming light brown at maturity, 1(–3)-septate, not constricted at the septa, slightly curved, smooth-walled, bearing delicate hyaline appendages over ends with wing-like appendages near the central septum.
Culture characteristics: Colonies on PDA reaching 40 mm diam., after 2 weeks at 25 °C, circular, white to cream or pale yellowish, intermixed with yellowish to orangish hyphae; reverse cream to white yellowish at the margin, yellowish-brown at the centre, medium dense to dense, irregular, flattened to slightly raised, fluffy to feathery, effuse.
Known distribution: China (Hyde et al. 2020a, Zhang et al. 2024, this study), Thailand (Liu et al. 2015).
Material examined: China, Yunnan Province, Xishuangbanna City, Xishuangbanna Dai Nationality Park, on dead segment of Borassus flabellifer, 5 Feb 2023, Y.R. Xiong and L. Lu, XG250 (MHZU 23-0180, new host record), living cultures ZHKUCC 24-0167, other living cultures ZHKUCC 24-0168.
GenBank numbers: ZHKUCC 24-0167: ITS – PV578140, LSU – PV578310, SSU – PV578488, tef1-α – PV608822; ZHKUCC 24-0168: ITS – PV578141, LSU – PV578311, SSU – PV578489, tef1-α – PV608823.
Notes: Two collections obtained in this study clustered with Byssosphaeria musae with 97% ML bootstrap support and 1.00 BYPP (Fig. 33). The nucleotide differences (excluding gaps) between our collection and B. musae (MFLUCC 11-0146) in ITS 0.59% (4/675 base pairs), LSU: 0.62% (5/812 base pairs), SSU: 0.11% (1/933 base pairs), and tef1-α: 0.32% (3/938 base pairs). Morphological evidence of conidiogenous cells and hyaline conidia well fits with B. musae (Liu et al. 2015, Hyde et al. 2020a, Zhang et al. 2024) and thus, we identify our collection as B. musae. Byssosphaeria musae was introduced on the leaf sheath of Musa species from Thailand by Liu et al. (2015). Subsequently, Hyde et al. (2020a) reported a new record on the decaying frond of a palm from China. Zhang et al. (2024) reported a new record on decaying rachides and petioles of Cocos nucifera from China. To our knowledge, this is the first record of B. musae from Borassus flabellifer.
Camposporium Harkn., Bull. Calif. Acad. Sci. 1(no. 1): 37 (1884)
Harkness (1884) proposed Camposporium with Ca. antennatum as the type species. Camposporium is a hyphomycetous genus characterized by dematiaceous, simple conidiophores, terminal, integrated, denticulate conidiogenous cells, and the conidia are typically cylindrical and elongate, multi-septate, rounded at one or both ends, often the cells at each end are paler in pigmentation than the central cells, the apex is either simple or has one or more cylindrical appendages, the base typically has a persistent portion of the denticle attached (Hughes 1951, Ellis 1971, Ichinoe 1971, Whitton et al. 2002, Koukol & Delgado 2021). Crous et al. (2018) constructed a phylogenetic tree for Camposporium based on LSU. Subsequently, phylogenetic studies mainly used SSU, LSU, ITS and tef1-α or rpb2 to analyse (Hyde et al. 2020b, Calabon et al. 2021, Tian et al. 2024a). Based on phylogenetic analysis using combined SSU, LSU, ITS and tef1-α, Fusiconidium was proposed to be combined under Camposporium (Hyde et al. 2020b). Koukol & Delgado (2021) formally synonymized Fusiconidium with Camposporium according to previous phylogenetic analysis and morphological evidence. We used ITS, LSU, SSU, and tef1-α to update phylogenetic analyses of Camposporium (Fig. 36). Although 29 epithets are listed under Camposporium (Index Fungorum, 2025 July), only 13 species have molecular data. Five species (about 17% of the species in this genus) have been reported from palms, including a new species described in this study (Supplementary Table 1).
Camposporium alangii H.Z. Du & Jian K. Liu, Mycology. 1–60 (2025) Fig. 37
Index Fungorum number: IF 855854
Saprobic on a dead segment of Livistona chinensis. Asexual morph: Hyphomycetous. Colonies on natural substrate, effuse, dark brown, velvety. Mycelium immersed, composed of hyaline, smooth, septate, branched hyphae. Conidiophores 17–30 × 7–10 μm (x̅ = 23 × 8.5 μm, n = 25), macronematous, mononematous, often procumbent on substrate, light brown to brown, unbranched, irregularly cylindrical, flexuous, septate, thick-walled. Conidiogenous cells monoblastic, terminal, integrated, subcylindrical, pale brown to hyaline. Conidia 50–80 (–100) × 9–13 μm (x̅ = 69 × 11 μm, n = 25), solitary, acrogenous, dry, cylindrical, elongate or irregular crooked, light brown, paler at apex and base cell, surface rugose, 9–12(–16)-septate, apex rounded, basal cell truncate. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, mycelia superficial, circular, with entire edge, flat, rugose in the centre; in reverse yellowish.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Qujing City, Sanyuan District, on dead segment of Livistona chinensis, 29 Dec 2022, Y.R. Xiong and L. Lu, XG131 (MHZU 23-0129, new host record); living culture ZHKUCC 24-0065, other living culture ZHKUCC 24-0066.
GenBank numbers: ZHKUCC 24-0065: ITS – PV578144, LSU – PV578314, SSU – PV578490; ZHKUCC 24-0066: ITS – PV578145, LSU – PV578315, SSU – PV578491.
Notes: Two collections from this study clustered with Camposporium alangii (UESTCC 23.0509, holotype) by 100% ML bootstrap support and 1.00 BYPP value (Fig. 36). Pairwise nucleotide differences (excluding gaps) between our isolate (ZHKUCC 24-0065) and Ca. alangii (UESTCC 23.0509) were analyzed, and only the ITS gene exhibited 0.4% differences (2/485 base pairs). Morphologically, our species aligns with the concepts of Ca. alangii (Du et al. 2025b, Fig. 37). Based on morphology and phylogeny, we identified our collection as Ca. alangii. Camposporium alangii was reported by Du et al. (2025b) from dead branches of Alangium chinense. To our knowledge, this is the first report of Ca. alangii from Livistona chinensis.
Neomassariaceae Ariyaw., Jaklitsch & Voglmayr, Cryptog. Mycol. 39 (3): 367 (2018)
Neomassaria Mapook, Camporesi & K.D. Hyde, Fungal Diversity 80: 74 (2016)
Neomassaria was proposed by Hyde et al. (2016) in Massariaceae and typified by Neom. fabacearum. A second species Neo. formosana was introduced by Ariyawansa et al. (2018) and proposed a new family, Neomassariaceae, to accommodate Neomassaria based on phylogenetic analyses of concatenated LSU, rpb2, SSU and tef1-α sequence data, as a monophyletic lineage within Pleosporales (Ariyawansa et al. 2018). The genus has been reported with sexual and asexual morphs (coelomycetous and hyphomycetous). The sexual morph of Neomassaria is characterized by immersed, subglobose to globose ascomata, a central ostiole, a peridium comprising cells of textura angularis, and pseudoparaphyses. Asci are 8-spored, bitunicate oblong to cylindrical pedicellate, containing ellipsoid to fusiform, 1-septate, hyaline ascospores, with or without a gelatinous sheath (Hyde et al. 2016, Zhang et al. 2024). The coelomycetous asexual morph is characterized by immersed conidiomata, with a central ostiole, conidiomatal wall composed of brown cells of textura angularis, conidiophores reduced to conidiogenous cells, polyphialidic sporodochial conidiogenous cells, terminal, integrated, subcylindrical to cylindrical, with minute periclinal thickenings, with oblong conidia, hyaline and aseptate, forming conidial chains that remain attached (Lu et al. 2025). The hyphomycetous morph has macronematous and mononematous conidiophores, solitary, erect, unbranched, brown, septate, smooth-walled; monoblastic and holoblastic conidiogenous cells, terminal, brown, with pale brown to brown conidia, acrogenous, solitary, obclavate, septate, hyaline towards the apex (Zhang et al. 2024). We used ITS, LSU, SSU, rpb2 and tef1-α to update phylogenetic studies for Neomassaria (Fig. 38). There are 12 species accepted in Neomassaria (Index Fungorum, 2025 July, Lu et al. 2025), and all species are confirmed by molecular data (Liu et al. 2024a, Zhang et al. 2024). Four species (about 33% of the species in this genus) have been reported from palms (Supplementary Table 1), including two new host records of Neomassaria introduced from different palm species from China in this study.
Neomassaria livistonae S.N. Zhang, K.D. Hyde & Jian K. Liu, Fungal Diversity 127: 149 (2024) Fig. 39
Index Fungorum number: IF 901931; Facesoffungi number: FoF 15957
Saprobic on a dead segment of Phoenix loureiroi. Sexual morph: Ascomata 100–210 × 180–240 μm (x̄ = 148 × 207 μm, n = 15), immersed to semi-immersed in a pseudostroma, visible as black dots or lenticular shapes in a black area on host surface, solitary or scattered, with a central ostiole, coriaceous, subglobose, unilocular. Ostioles central, crest-like. Peridium 20–40 µm wide (x̅ = 29 µm, n = 20), composed of cells of textura angularis, outer layer brown and thicker, inner layer hyaline. Hamathecium 1.5–2.5 µm wide (x̅ = 2.1 µm, n = 20), pseudoparaphyses, embedded in a gelatinous matrix. Asci 80–100 × 7–9 μm (x̄ = 86 × 8.1 μm, n = 20), bitunicate, fissitunicate, cylindrical, 8-spored, hyaline, apically rounded, with a short pedicel, apically rounded with an inconspicuous ocular chamber. Ascospores 25–30 × 3–4 μm (x̄ = 27 × 3.6 μm, n = 20), overlapping 1–2-seriate, fusiform and tapering to both ends, hyaline, 1-septate, constricted at septum, guttulate, smooth-walled, sheath absent. Asexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4–5 cm diam., at 25 °C, filamentous, slight raised, with undulate edge, dense, furry, cottony white aerial hyphae covered the colony, above white, below green in the middle, wrinkled, with a distinct pale-yellow halo outside.
Known distribution: China (Zhang et al. 2024, this study).
Material examined: China, Yunnan Province, Xishuangbanna, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, on dead segment of Phoenix loureiroi, 5 February 2023, Y.R. Xiong, XG154 (MHZU 23-0136, new host record), living culture ZHKUCC 24-0079, other living culture ZHKUCC 24-0080.
GenBank numbers: ZHKUCC 24-0079: ITS – PV578212, LSU – PV578378, SSU – PV578522, tef1-α – PV608870, rpb2 – PV595338; ZHKUCC 24-0080: ITS – PV578213, LSU – PV578379, SSU – PV578523, tef1-α – PV608871, rpb2 – PV595339.
Notes: Two collections obtained in this study clustered with Neo. livistonae (SNC 146, holotype) by 99% ML bootstrap support and 1.00 BYPP (Fig. 38). Pairwise nucleotide differences (excluding gaps) between our isolate (ZHKUCC 24-0079) and Neo. livistonae (SNC 146) showed that ITS, LSU, SSU, and rpb2 sequences are identical, whereas the tef1-α gene exhibited 0.4% differences (4/946 base pairs). Morphologically, our species aligns with the concepts of Neo. livistonae. However, compared to the holotype of our collection, which has cylindrical asci and ascospores lacking a sheath, the holotype exhibits cylindric-clavate asci with a distinct ocular chamber and ascospores surrounded by a thin mucilaginous sheath (Zhang et al. 2024, Fig. 39). Based on the phylogenetic analysis, we identified our collection as Neo. livistonae. Neomassaria livistonae was reported by Zhang et al. (2024) from decaying petioles of Livistona chinensis (Zhang et al. 2024). To our knowledge, this is the first report of Neo. livistonae from Phoenix loureiroi.
Neomassaria formosana H.A. Ariyaw., Jaklitsch & Voglmayr, Cryptogamie, Mycologie 39 (3): 368 (2018) Fig. 40
Index Fungorum number: IF 827114
Saprobic on dead segment of Elaeis guineensis. Sexual morph: Ascomata 120–210 × 170–260 μm (x̄ = 155.4 × 219.6 μm, n = 15), immersed to erumpent, visible as black dots on host surface, solitary to scattered, with a central ostiole, coriaceous, subglobose, unilocular. Ostioles central. Peridium 15–25 µm wide (x̅ = 19.8 µm, n = 20), hyaline to brown, comprising several layers of textura angularis cells, thinner-walled and lighter to the inner side, outside fusing with the host. Hamathecium 1–2 µm wide (x̅ = 1.3 µm, n = 20), pseudoparaphyses, embedded in a gelatinous matrix. Asci 65–95 × 6–8.5 μm (x̄ = 79o.6 × 7.2 μm, n = 20), bitunicate, fissitunicate, cylindrical, 8-spored, hyaline, apically rounded, with a short pedicel. Ascospores 17–25 × 2.5–5 μm (x̄ = 21.2 × 3.7 μm, n = 20), overlapping 1–2-seriate, fusiform and tapering to both ends, hyaline, 1-septate, constricted at septum, guttulate, smooth-walled. Asexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 5–6 cm diam., at 25 °C, circular, flat, filiform margin, with white aerial mycelium, floccose, above white to greyish green, reverse pale yellow to greenish.
Known distribution: China (Ariyawansa et al. 2018, Zhang et al. 2024, Lu et al. 2025, this study).
Material examined: China, Yunnan Province, Xishuangbanna, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, on dead segment of Elaeis guineensis, 5 February 2023, Y.R. Xiong, XG181 (MHZU 23-0150, new host record), living culture ZHKUCC 24-0107, other living culture ZHKUCC 24-0108.
GenBank numbers: ZHKUCC 24-0107: ITS – PV578210, LSU – PV578376, SSU – PV578520, rpb2 – PV595336, tef1-α – PV608868; ZHKUCC 24-0108: ITS – PV578211, LSU – PV578377, SSU – PV578521, rpb2 – PV595337, tef1-α – PV608869.
Notes: Two collections obtained in this study clustered with Neo. formosana by 99% ML bootstrap support and 1.00 BYPP (Fig. 38). Pairwise nucleotide differences analysis (excluding gaps) between our isolate (ZHKUCC 24-0107) and the ex-type species Neo. formosana (NTUCC 17-007) showed SSU and rpb2 sequences are similar, and LSU and tef1-α genes exhibited 0.1% (1/879 bp and 1/723 bp, respectively). Morphologically, our collection is similar to Neo. formosana by having cylindrical asci and fusiform 1-septate ascospores (Ariyawansa et al. 2018, Zhang et al. 2024, Fig. 40). Therefore, based on the phylogenetic analysis, we identified our collection Neo. formosana. Neomassaria formosana was reported by Ariyawansa et al. (2018) as saprobic on dead stems of Rhododendron species. Another two host records were collected from Trachycarpus fortunei and Coffea sp. (Zhang et al. 2024, Lu et al. 2025). Herein, we introduce Neo. formosana from Elaeis guineensis for the first time.
Occultibambusaceae D.Q. Dai & K.D. Hyde, Fungal Diversity 82: 25 (2016)
Neooccultibambusa Doilom & K.D. Hyde, Fungal Diversity 82: 126 (2016)
Doilom et al. (2017) established Neooccultibambusa with Neo. chiangraiensis as the type species based on morphological evidence and phylogenetic analysis of combined SSU, LSU, and rpb2 sequence data. Neooccultibambusa species are mostly reported in their sexual morphs, which are characterized by black and immersed to semi-immersed ascomata with a central ostiole, hyphae-like and pseudoparaphyses hamathecium, asci are bitunicate and furcate to rounded pedicel with an ocular chamber, conidia are 1–3 transverse septa and surrounded or not by a gelatinous sheath (Doilom et al. 2017). Several Neooccultibambusa species have been reported to have asexual morphs that form chlamydospores in culture (Doilom et al. 2017). Phylogenetic analyses of Neooccultibambusa mainly use SSU, LSU, ITS and rpb2 or add tef1-α sequence data (Tibpromma et al. 2018, Yu et al. 2021). In this study, we used ITS, LSU, SSU, and tef1-α to update phylogenetic analyses of Neooccultibambusa (Fig. 41). Eight epithets are listed under Neooccultibambusa (Index Fungorum, 2025 July), and all species have molecular data. Four species (50% of the species in this genus) have been reported from palms, including a new species described in this study (Supplementary Table 1).
Neooccultibambusa calami Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 42
Index Fungorum number: IF 904920; Facesoffungi number: FoF 19223
Etymology: Refers to the host genus Calamus, from which the species was collected.
Saprobic on dead rachis of Calamus sp. Asexual morph: Not observed. Sexual morph: Ascomata 150–190 × 200–300 μm (x̅ = 172 × 256 μm, n = 15), solitary or gregarious, scattered, immersed, uni-loculate to multi-loculate, black papillate dots on host surface, subglobose or irregular, ostiolate. Locule 100–150 × 200–240 μm (x̅ = 124 × 221 μm, n = 10), subglobose or irregular, ostiolate. Ostioles 65–90 × 55–70 μm (x̅ = 80 × 61 μm, n = 15), circular, central, periphysate, composed of brown textura angularis cells. Peridium 15–35 μm wide, composed of brown to dark brown textura angularis cells, thicker outwardly. Hamathecium 2–3 μm wide, hyphae-like, pseudoparaphyses, septate, embedded in a gelatinous matrix. Asci 50–120 × 9–10 μm (x̅ = 67 × 9.5 μm, n = 25), 8-spored, bitunicate, cylindric-clavate, with a short furcate to rounded pedicel, apically rounded, with an ocular chamber. Ascospores 16–18 × 3–5 μm (x̅ = 16.7 × 3.8 μm, n = 25), overlapping biseriate, hyaline, fusiform to fusoid, tapering and round towards the ends, 1-septate, constricted at the central septum, becoming pale brown and forms a septum in the middle of one of the cells when senescent (Fig. 42-o), guttulate, smooth, surrounded by mucilaginous sheath.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, convex, aerial in the centre, edge entire, white to black mycelium with entire margin; in reverse black.
Known distribution: Thailand (this study).
Material examined: Thailand, Narathiwat Province, in an unidentified beach, on dead rachis of Calamus sp., 6 Aug 2023, Y.R. Xiong, XG357 (MFLU 25-0157, holotype); ex-type MFLUCC 25-0224; other ex-type living culture MFLUCC 25-0225.
GenBank numbers: MFLUCC 25-0224: ITS – PV578216, LSU – PV578382, SSU – PV578526, tef1-α – PV608874; MFLUCC 25-0225: ITS – PV578217, LSU – PV578383, SSU – PV578527, tef1-α – PV608875.
Notes: Two collections from this study formed a separate lineage and clustered with Neooccultibambusa jonesii in the phylogenetic tree with 94% ML bootstrap and 1.00 BYPP support (Fig. 41). The nucleotide differences (excluding gaps) between Neo. calami (MFLUCC 25-0224) and Neo. jonesii (MFLUCC 16-0643) were checked and given as follows: LSU: 3.78% (33/874 base pairs), and SSU: 1.06% (10/943 base pairs). Neooccultibambusa calami has ascospores surrounded by a mucilaginous sheath and hyaline, differing from Neo. jonesii, which has ascospores without appendages or mucilaginous sheath and are pale brown to dark brown (Jayasiri et al. 2016a, Fig. 42). Based on phylogenetic placement and morphological variation, we introduce Neo. calami as a new species.
Seriascoma Phookamsak, D.Q. Dai & K.D. Hyde, Fungal Diversity 82: 30 (2016)
Seriascoma was proposed by Dai et al. (2017) and typified by Se. didymosporum. Seriascoma species are saprobic, mainly found on bamboo and decaying wood in terrestrial or freshwater habitats in China and Thailand (Dai et al. 2017, Rathnayaka et al. 2019, Dong et al. 2020, Calabon et al. 2024). The sexual morph of Seriascoma is characterized by solitary or gregarious, erumpent, subglobose to elongated, uni- to multi-loculate, coriaceous ascostromata, which are immersed under a clypeus; bitunicate and fissitunicate asci, 8-spored, clavate, with short to long furcate pedicels, and contain fusiform ascospores, asymmetric, 1-septate, hyaline (Dai et al. 2017, Hongsanan et al. 2020a). The asexual morph is characterized by eustromatic and conical conidiomata, black, uni- to multi-loculate, with enteroblastic, conidiogenous cells, phialidic, cylindrical to ampulliform, producing oblong, hyaline and aseptate conidia (Dai et al. 2017, Calabon et al. 2024). In this study, we use ITS, LSU, SSU, rpb2 and tef1-α to update phylogenetic studies for Seriascoma (Fig. 41). Five species are accepted in Seriascoma (Index Fungorum, 2025 July), and all have been confirmed by molecular data of combined ITS, LSU, SSU, rpb2 and tef1-α sequences (Dai et al. 2017, Senanayake et al. 2023). There are no previous records of Seriascoma species occurring on palm hosts. We report a new host record for Se. didymosporum on Arenga obtusifolia in China, representing the first documented occurrence of Seriascoma on a palm species (Supplementary Table 1).
Seriascoma didymosporum Phookamsak, D.Q. Dai, Karun. & K.D. Hyde, Fungal Diversity 82: 32 (2016) Fig. 43
Index Fungorum number: IF 552015; Facesoffungi number: FoF 01979
Saprobic on dead segment of Arenga obtusifolia. Sexual morph: Ascomata 90–130 × 170–260 μm (x̄ = 104.9 × 218 μm, n = 15), gregarious, immersed beneath clypeus, erumpent in linear rows, coriaceous, subglobose, unilocular, ostiolate. Peridium 15–20 µm wide (x̅ = 16.6 µm, n = 20), composed of cells of textura angularis, outer layer brown and thicker, inner layer hyaline. Hamathecium 2–3 µm wide (x̅ = 2.5 µm, n = 20), pseudoparaphyses, numerous, cellular, hypha-like, hyaline, septate. Asci 55–65 × 9–11 μm (x̄ = 61.7 × 9.9 μm, n = 20), bitunicate, fissitunicate, 8-spored, clavate, long pedicellate with club-like, hyaline, apically rounded, with an ocular chamber when mature. Ascospores 13–16 × 4–6.5 μm (x̄ = 14.6 × 5.4 μm, n = 20), overlapping 1–2-seriate, clavate to fusiform, hyaline, 1-septate, constricted at septum, upper cell shorter and wider than lower cell, guttulate, slightly curved, smooth-walled. Asexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4–5 cm diam. at 25 °C, circular, dense, flat, smooth with entire edge, velvety to floccose, slightly radiating, reddish brown to dark green from above, reddish brown to black from below.
Known distribution: Thailand (Dai et al. 2017), China (Dong et al. 2020, this study).
Material examined: China, Yunnan Province, Xishuangbanna, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, on dead segment of Arenga obtusifolia, 5 February 2023, Y.R. Xiong, XG160 (MHZU 23-0141, new host record), living culture ZHKUCC 24-0089, other living culture ZHKUCC 24-0090.
GenBank numbers: ZHKUCC 24-0089: ITS – PV578252, LSU – PV578420, SSU – PV578550, rpb2 – PV595360; ZHKUCC 24-0090: ITS – PV578253, LSU – PV578421, SSU – PV578551, rpb2 – PV595361.
Notes: Two collections obtained in this study clustered with Se. didymosporum (MFLUCC 11-0179-ex-type, and MFLUCC 11-0194) by 100% ML bootstrap support and 1.00 BYPP (Fig. 41). In Pairwise nucleotide differences (excluding gaps) analysis between our isolate (ZHKUCC 24-0089) and Se. didymosporum (MFLUCC 11-0179, ex-type) showed that LSU, SSU, and rpb2 sequences are identical, whereas the ITS gene exhibited 1.6% differences (9/546 base pairs). Morphologically, our species aligns with the concepts of the holotype Se. didymosporum by clavate asci and clavate to fusiform ascospores that are hyaline, 1-septate (Dai et al. 2017, Fig. 43). Seriascoma didymosporum, the type species of the genus Seriascoma, has previously been reported from terrestrial habitats associated with bamboo (Dai et al. 2017) and from submerged, unidentified wood in freshwater environments (Dong et al. 2020). Therefore, based on the phylogenetic analysis, we identified our collection as Se. didymosporum, which is a new host record from Arenga obtusifolia.
Phaeoseptaceae Boonmee, Thambugala & K.D. Hyde, Mycosphere 9: 323 (2018)
Pleopunctum N.G. Liu, K.D. Hyde & J.K. Liu, Mycosphere 10 (1): 767 (2019)
Liu et al. (2019b) established Pleopunctum with Pl. ellipticum as the type species based on morphological evidence and phylogenetic analysis of combined SSU, LSU, ITS and tef1-α. Pleopunctum is a hyphomycetous genus characterized by gregarious, superficial, brown to black colonies, mononematous, septate conidiophores, monoblastic conidiogenous cells, multi-septate, muriform and oval to ellipsoidal conidia, often with a hyaline, elliptical to globose basal cell (Liu et al. 2019b). Subsequent phylogenetic studies mainly used SSU, LSU, ITS, tef1-α and rpb2 or without rpb2, for species identification (Phukhamsakda et al. 2020, Boonmee et al. 2021, Senwann et al. 2021, Wanasinghe et al. 2022, Xu et al. 2023, Ren et al. 2024, Yu et al. 2024). In this study, we used ITS, LSU, SSU, tef1-α and rpb2 to update the phylogenetic tree of Pleopunctum (Fig. 44). Currently, 11 epithets are listed under Pleopunctum (Index Fungorum, 2025 July), with all species having molecular data. We describe a new species of Pleopunctum, the first record of the genus on palms (Supplementary Table 1).
Pleopunctum phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 45
Index Fungorum number: IF 904921; Facesoffungi number: FoF 19224
Etymology: Refers to the host genus phoenix, from which the species was collected.
Saprobic on dead leaf sheath of Phoenix sylvestris. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, punctiform, scattered to gregarious, dark brown to black, glistening. Mycelium immersed, composed of dark brown to hyaline, smooth, septate, branched hyphae. Conidiophores 2–3 μm diam., macronematous, mononematous, pale brown to hyaline. Conidiogenous cells monoblastic, integrated, terminal, pale brown, smooth-walled. Conidia 25–30 × 15–20 μm (x̅ = 29 × 18 μm, n = 25), solitary, ellipsoidal, subcylindrical or muriform, rounded at the apex, multi-septate, slightly constricted at the septa, slightly curved, brown to dark brown, paler at the base, with a surrounding sheath, thick at medium part, often with a hyaline, elliptical to globose basal cell 10–20 × 10–15 μm (x̅ = 15 × 14 μm, n = 25), multiple small hyaline basal cells are occasionally observed. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 1.5 cm diam., at 25 °C, irregular circular, striated, umbonate, white margin between grey in the central cycle and pale grey in the outer circle; in reverse black in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Ganzhou City, Xingda Restaurant, on dead leaf sheath of Phoenix sylvestris, 9 Apr 2024, Y.R. Xiong, XG368 (MHZU 24-0483, holotype); ex-type ZHKUCC 25-0025; other ex-type living culture ZHKUCC 25-0026.
GenBank numbers: ZHKUCC 25-0025: ITS – PV578228, LSU – PV578394, SSU – PV578532, tef1-α – PV608878, rpb2 – PV595348; ZHKUCC 25-0026: ITS – PV578229, LSU – PV578395, SSU – PV578533, tef1-α – PV608879, rpb2 – PV595349.
Notes: Two collections clustered in Pleopunctum clade and formed a sister lineage to Pl. baoshanense and Pl. pseudoellipsoideum in the phylogenetic tree with 89% ML and 0.93 BYPP (Fig. 44). The nucleotide differences (excluding gaps) between Pl. phoenicis (ZHKUCC 25-0025) and its phylogenetically related species were checked and given as follows, Pl. baoshanense (KUNCC 21-0494) - tef1-α: 2.90% (27/930 base pairs), rpb2: 5.19% (53/1020 base pairs); Pl. pseudoellipsoideum (MFLUCC 19-0391) - ITS: 1.16% (6/519 base pairs), LSU: 1.39% (12/866 base pairs), tef1-α: 3.12% (30/961 base pairs), rpb2: 4.36% (44/1010 base pairs). Morphologically, Pl. phoenicis has conidia with a surrounding sheath, which is not reported in Pl. baoshanense and Pl. pseudoellipsoideum (Liu et al. 2019b, Ren et al. 2024). Moreover, Pl. phoenicis occasionally has multiple small hyaline basal cells in conidia, while Pl. baoshanense has only one elliptical to globose basal cell (Ren et al. 2024). Based on phylogenetic placement and morphological variations, we introduce Pl. phoenicis as a new species.
Pseudomassarinaceae Phukhams. & K.D. Hyde, Fungal Diversity 102: 99 (2020)
Pseudomassarina Phukhams. & K.D. Hyde, Fungal Diversity 102: 101 (2020)
Phukhamsakda et al. (2020) established Pseudomassarina with Pseu. clematidis as the type species based on morphological evidence and phylogenetic analysis of combined ITS, SSU, LSU, tef1-α and rpb2. Pseudomassarina was introduced as a sexual genus characterized by obpyriform to subglobose, coriaceous, and carbonaceous ascomata, papillate ostioles, ascospores with deeply constricted septa, the upper cell longer and wider than the lower cell, with a mucilaginous sheath (Phukhamsakda et al. 2020). For the updated phylogenetic analyses, ITS, SSU, LSU, tef1-α and rpb2 were employed in this study (Fig. 46). Only one epithet is listed under Pseudomassarina (Index Fungorum, 2025 July), and it has molecular data. We describe a new species of Pseudomassarina, which is the first report of the genus from palms (Supplementary Table 1).
Pseudomassarina roystoneae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 47
Index Fungorum number: IF 904922; Facesoffungi number: FoF 19225
Etymology: Refers to the host genus Roystonea, from which the species was collected.
Saprobic on dead rachis of Roystonea regia. Asexual morph: Not observed. Sexual morph: Ascomata 350–500 × 250–350 μm (x̅ = 380 × 290 μm, n = 10), solitary, scattered or gregarious, semi-immersed, part immersed beneath host dehiscent epidermis, appearing numerous, raised, papillate-shaped areas on the host surface, subglobose, coriaceous, unilocular, black, ostiolate. Ostioles carbonaceous perforated-like opening, central. Setae 2–3.5 μm wide, erect or slightly curved, pale brown. Peridium 40–80 μm wide, multilayered, outer layered comprising thick-walled brown to dark brown cells of textura angularis, inner layers comprising pale brown to hyaline cells of textura prismatica. Hamathecium 1.5–2.5 μm wide, pseudoparaphyses, composed of dense, hyaline, filiform, trabeculate (Liew et al. 2000), branched, anastomosing among the asci. Asci 110–120 × 14–18 μm (x̅ = 114 × 15.4 μm, n = 30), 8-spored, bitunicate, fissitunicate, cylindric-clavate, short furcate pedicel, apically rounded with ocular chamber clearly visible. Ascospores 30–40 × 5–9 μm (x̅ = 35 × 6 μm, n = 40), overlapping, fusiform, hyaline, smooth-walled, tapering towards the ends, rounded or acute at both ends, guttulate, 1–3-septate, constricted at the medium septum, cell upper cell wider than lower cell, smooth-walled, surrounded by a thin mucilaginous sheath.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, dense, striated, white mycelium on the surface with entire margin; in reverse black in the middle and brown at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, Xishuangbanna Dai Nationality Park, on dead rachis of Roystonea regia, 6 Feb 2023, Y.R. Xiong and L. Lu, XG228 (MHZU 24-0453, holotype); ex-type ZHKUCC 25-0007; other ex-type living culture ZHKUCC 25-0008.
GenBank numbers: ZHKUCC 25-0007: ITS – PV578242, LSU – PV578410, SSU – PV578544, tef1-α – PV608890, rpb2 – PV595356; ZHKUCC 25-0008: ITS – PV578243, LSU – PV578411, SSU – PV578545, tef1-α – PV608891, rpb2 – PV595357.
Notes: Two collections clustered in Pseudomassaria clade and formed a sister lineage to Pseu. clematidis in the phylogenetic tree with 100% ML bootstrap support and 1.00 BYPP (Fig. 46). The nucleotide differences, (excluding gaps) between our collection (ZHKUCC 25-0007) and Pseu. clematidis (MFLU 16-0493) were checked and given as follows; ITS: 13.59% (64/471 base pairs), LSU: 2.86% (23/804 base pairs), SSU: 0.45% (4/884 base pairs), tef1-α: 6.69% (60/896 base pairs), and rpb2: 13.19% (128/970 base pairs). Morphologically, Pseu. roystoneae has setae which are not reported from Pseu. clematidis (Phukhamsakda et al. 2020). In addition, Pseu. roystoneae has 1–3-septate ascospores, while those of Pseu. clematidis are 1-septate (Phukhamsakda et al. 2020). Based on phylogenetic placement and morphological variations, we introduce Pseu. roystoneae as a new species.
Sulcatisporaceae Kaz. Tanaka & K. Hiray., Stud. Mycol. 82: 119 (2015)
Parasulcatispora Phukhams. & K.D. Hyde, Fungal Diversity 102: 1–203 (2020).
Phukhamsakda et al. (2020) established Parasulcatispora with Pa. clematidis as the type species. The sexual morph of Parasulcatispora is characterized by coriaceous semi-immersed ascomata, central ostioles filled with hyaline periphyses, trabeculate pseudoparaphyses, bitunicate and fissitunicate asci and 1-euseptate ascospores (Phukhamsakda et al. 2020). Following Phukhamsakda et al. (2020), phylogenetic analyses were conducted using combined SSU, LSU, tef1-α and rpb2 sequences to update the phylogenetic tree for Parasulcatispora (Fig. 48). Only one epithet is listed under Parasulcatispora (Index Fungorum, 2025 July) with designated molecular data. We describe a new species of Parasulcatispora, which is the first report of this genus from a palm species (Supplementary Table 1).
Parasulcatispora bismarckiae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 49
Index Fungorum number: IF 904923; Facesoffungi number: FoF 19226
Etymology: Refers to the host genus Bismarckia, from which the species was collected.
Saprobic on dead segment of Bismarckia nobilis. Asexual morph: Coelomycetous. Conidiomata 250–320 × 80–100 μm (x̅ = 286 × 90 μm, n = 10), pycnidial, immersed to semi-immersed, solitary, multilocular, raising host epidermal and form clypeus or slit-like. Peridium 8–15 μm, composed of thin-walled, brown cells, textura angularis, inner wall with hyaline textura globulosa cells. Conidiophores reduced to conidiogenous cells. Conidiogenous cell 3–4 × 1–2 μm (x̅ = 3.6 × 1.6 μm, n = 25), holoblastic, annellate, phialidic to cylindrical, slightly curved, hyaline, smooth-walled, arising from stratum. Conidia 7–11 × 3–4 μm (x̅ = 8.3 × 3.5 μm, n = 25), oblong to ellipsoid, slightly curved, truncate to rounded apex, aseptate, hyaline, 1–2 guttulate. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, filamentous and irregular, with fluffy, dense, pale pink mycelium on the surface; in reverse yellow-brown in the middle and red-brown at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, on dead leaf sheath of Bismarckia nobilis, 4 Feb 2023, Y.R. Xiong and L. Lu, XG283 (MHZU 23-0190, holotype), ex-type ZHKUCC 24-0187, other ex-type living culture ZHKUCC 24-0188.
GenBank numbers: ZHKUCC 24-0187: ITS – PV578220, LSU – PV578386, SSU – PV578528, tef1-α – PV608876, rpb2 – PV595342; ZHKUCC 24-0188: ITS – PV578221, LSU – PV578387, SSU – PV578529, tef1-α – PV608877, rpb2 – PV595343.
Notes: Two collections clustered in Parasulcatispora clade and formed a sister lineage to Pa. clematidis in the phylogenetic tree with 94% ML bootstrap support and 1.00 BYPP values (Fig. 48). The nucleotide differences (excluding gaps) between Pa. bismarckiae (ZHKUCC 24-0187) and Pa. clematidis (MFLUCC 16-0909) were checked and given as follows, ITS: 8.10% (41/506 base pairs), LSU: 1.65% (14/847 base pairs), and tef1-α: 2.58% (23/892 base pairs). Parasulcatispora bismarckiae is characterised by oblong to ellipsoid conidia and annellate conidiogenous cells, while Pa. clematidis is a sexual morph (Phukhamsakda et al. 2020). Based on phylogenetic placement, we introduce Pa. bismarckiae as a new species.
Tropicomicromyces Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Index Fungorum number: IF 904924; Facesoffungi number: FoF 19227
Etymology: Refers to the tropical habitat and microfungal morphology of the type species.
Saprobic on dead petiole of Livistona sp. Asexual morph: not observed. Sexual morph: Ascomata semi-immersed, solitary or aggregated in small groups, scattered, globose to subglobose, dark brown, visible as dark brown area with an erumpent black dot or papilla, coriaceous, ostiolate. Peridium blackish to dark brown cells of textura angularis. Hamathecium anastomosing, septate, branched, hyaline, pseudoparaphyses. Asci 8-spored, bitunicate, cylindric-clavate, with a short pedicel, apically rounded, with minute ocular chamber. Ascospores overlapping biseriate, lunate to fusiform, 1-septate, constricted at the septum, and slightly constricted at the central part of each cell, hyaline, brown when mature, surrounded by a mucilaginous sheath.
Type species: Tropicomicromyces livistonae Y.R. Xiong, Manawas. & K.D. Hyde
Notes: Based on our phylogenetic result (Fig. 48), Tropicomicromyces formed a distinct clade in Sulcatisporaceae and clustered with Anthosulcatispora and Neobambusicola. Morphologically, Tropicomicromyces consists of the basal character of Sulcatisporaceae (Tanaka et al. 2015). However, it differs from Anthosulcatispora and Neobambusicola by having 8-spored asci with a minute ocular chamber, with ascospores lunate to ellipsoid, 2-celled, and a mucilaginous sheath (Phookamsak et al. 2019, de Silva et al. 2022b). According to morphological differences and phylogenetic results, we propose a new genus Tropicomicromyces typified by Tr. livistonae. Moreover, based on N. magnoliae and N. palmae clustering with Tr. livistonae in phylogenetic analysis (Fig. 48), and we propose two new combinations for them (see below). The genus has two host palm species (about 66% of the species in this genus; Supplementary Table 1).
Tropicomicromyces livistonae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 50
Index Fungorum number: IF 904925; Facesoffungi number: FoF 19228
Etymology: Refers to the host genus Livistona, from which the species was collected.
Saprobic on dead petiole of Livistona sp. Asexual morph: Not observed. Sexual morph: Ascomata 300–400 × 390–500 μm (x̅ = 365 × 440 μm, n = 10) semi-immersed, solitary or aggregated in small groups, scattered, globose to subglobose, dark brown, visible as dark brown area with an erumpent black dot or papilla, coriaceous, ostiolate. Peridium 35–50 μm, blackish to dark brown cells of textura angularis. Hamathecium 1.5–2 μm wide anastomosing, septate, branched, hyaline, pseudoparaphyses. Asci 60–85 × 8.5–12.5 μm (x̅ = 74.5 × 10 μm, n = 25) 8-spored, bitunicate, cylindric-clavate, with a short pedicel, apically rounded, with a minute ocular chamber. Ascospores 17–27 × 3.5–6.5 μm (x̅ = 21.6 × 4.8 μm, n = 40), overlapping biseriate, lunate to fusiform, 1-septate, constricted at the septum, and slightly constricted at the central part of each cell, hyaline, brown when mature, surrounded by a mucilaginous sheath.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 4 cm diam., at 25 °C, circular or irregular, flat to slightly raised, mycelium velvety towards the margin, greyish green, reverse dull dark brown.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead petiole of Livistona sp., 8 Jul 2022, Y.R. Xiong and L. Lu, XG066 (MHZU 24-0448, holotype); ex-type ZHKUCC 25-0393; other ex-type living culture ZHKUCC 25-0394.
GenBank numbers: ZHKUCC 25-0393: ITS – PV578260, LSU – PV578428, SSU – PV578556, tef1-α – PV608898, rpb2 – PV595364; ZHKUCC 25-0394: ITS – PV578261, LSU – PV578429, SSU – PV578557, tef1-α – PV608899, rpb2 – PV595365.
Notes: Two collections formed a separate lineage and clustered with Tropicomicromyces magnoliae and Tr. palmae in the phylogenetic tree with 93% ML and 1.00 BYPP bootstrap support (Fig. 48). The nucleotide differences (excluding gaps) between Tr. livistonae and its phylogenetically related species were as follows: Tr. magnoliae (HKAS 107122a) - ITS: 3.55% (23/647 base pairs), tef1-α: 3.19% (29/909 base pairs); Tr. palmae - ITS: 5.60% (27/482 base pairs), tef1-α: 3.08% (29/942 base pairs), rpb2: 5.77% (52/901 base pairs). Tropicomicromyces magnoliae was reported as an asexual morph and Tr. palmae was reported as a sexual morph (de Silva et al. 2022b, Zhang et al. 2024). Tropicomicromyces livistonae differs from Tr. palmae by having ascospores that are lunate to fusiform and brown when mature, while Tr. palmae has hyaline fusiform ascospores (Zhang et al. 2024). Based on phylogenetic placement and morphological variations, we introduce Tr. livistonae as a new species.
Tropicomicromyces magnoliae (N.I. de Silva & Lumyong) Y.R. Xiong, Manawas. & K.D. Hyde, comb. nov.
Index Fungorum number: IF 904926; Facesoffungi number: FoF 19229
Basionym: Neobambusicola magnoliae N.I. de Silva & Lumyong, in de Silva et al., Journal of Fungi 8(10):1094 (2022)
Holotype: Thailand, Chiang Mai Province, dead twigs attached to Magnolia sp. (Magnoliaceae), 6 August 2019, N.I. de Silva, MGT53 (HKAS 107122).
Description: See de Silva et al. (2022).
Notes: Tropicomicromyces magnoliae was initially introduced as Neobambusicola magnoliae by de Silva et al. (2022b). It was described as an asexual morph that differs from Neobambusicola strelitziae by having aseptate, oblong to subcylindrical conidia (Crous et al. 2014b, de Silva et al. 2022b). Subsequently, phylogenetic analysis by Zhang et al. (2024) demonstrated that N. magnoliae, which clustered with N. palmae, formed an independent lineage distinct from Neobambusicola strelitziae. Our study further supports this finding, as N. magnoliae not only grouped with Tr. livistonae and N. palmae but also formed a distinct clade within Neobambusicola. Based on both morphological characteristics and phylogenetic evidence, Neobambusicola magnoliae is recombined as Tropicomicromyces magnoliae.
Tropicomicromyces palmae (S.N. Zhang, K.D. Hyde & Jian K. Liu) Y.R. Xiong, Manawas. & K.D. Hyde, comb. nov.
Index Fungorum number: IF 904927; Facesoffungi number: FoF 19230
Basionym: Neobambusicola palmae S.N. Zhang, K.D. Hyde & Jian K. Liu, in Zhang et al., Fungal Diversity 127: 55–301 (2024)
Holotype: Thailand, Chiang Mai Province, Mae Taeng District, Pa Pae, Mushroom Research Centre, on decaying rachides and petioles of a Calamus sp. (Arecaceae), 17 December 2018, S.N. Zhang, SNT307 (MFLU 24-0161); ex-type living culture MFLUCC 24-0185.
Description: See Zhang et al. (2024).
Notes: Tropicomicromyces palmae was initially introduced as Neobambusicola palmae by Zhang et al. (2024). It was described as the first sexual morph in Neobambusicola (Zhang et al. 2024). However, it is similar to Tr. livistonae by having 1-septate ascospores with a mucilaginous sheath. In addition, phylogenetically this species is closer to Tropicomicromyces than Neobambusicola (see Tropicomicromyces magnoliae notes). Based on both morphological characteristics and phylogenetic evidence, Neobambusicola palmae is recombined as Tropicomicromyces palmae.
Teichosporaceae M.E. Barr, Mycotaxon 82: 374 (2002)
Pseudoteichospora X.G. Tian, K.D. Hyde & Tibpromma, Mycosphere 15(1): 1–274 (2024).
Tian et al. (2024b) established Pseudoteichospora with P. thailandensis as the type species based on morphological evidence and phylogenetic analysis of combined ITS, LSU, SSU, rpb2 and tef1-α. Pseudoteichospora is a coelomycetous genus characterized by immersed or semi-immersed pycnidial conidiomata, papillate ostioles, phialidic and cylindrical conidiogenous cells and ellipsoidal to oval, aseptate conidia (Tian et al. 2024b, Du et al. 2025a). In this study, ITS, LSU, SSU, rpb2 and tef1-α were used to update phylogenetic studies for Pseudoteichospora (Fig. 51). Only three species are accepted (Index Fungorum, 2026 January), and all have molecular data. We describe a new host record for Pseudoteichospora, the first report of the genus from palms (Supplementary Table 1).
Pseudoteichospora hydei H.Z. Du & Jian K. Liu, Mycosphere 16(2) : 179–343 (2025). Fig. 52
Index Fungorum number: IF 857562; Facesoffungi number: FoF 17988
Saprobic on dead segment of Borassus flabellifer. Asexual morph: Coelomycetous. Conidiomata 150–200 × 100–190 μm (x̅ = 183 × 153 μm, n = 10), pycnidial, semi-immersed, unilocular, dark brown to black, solitary, globose to sub-globose, ostiolate. Ostioles central, wide, distinctly cylindrical. Peridium 16–20 μm wide, with outer layers of brown, cells of textura angularis, with a hyaline inner lining. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 10–20 × 2–4 μm (x̅ = 15 × 2.8 μm, n = 25), hyaline, phialidic, indeterminate, cylindrical and smooth-walled, most 1-cell, some proliferating. Conidia 5–7 × 2–4 μm (x̅ = 6 × 3.4 μm, n = 25), hyaline, 1-cell, oval to clavate with obtuse ends, guttulate. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, filamentous, umbonate, with fluffy, dense, white mycelium, grey in centre; in reverse cream in the middle and white at the margin.
Known distribution: China (Du et al. 2025a, this study).
Material examined: China, Yunnan Province, Xishuangbanna City, Xishuangbanna Dai Nationality Park, on dead segment of Borassus flabellifer, 6 Feb 2023, Y.R. Xiong and L. Lu, XG246 (MHZU 23-0177, new host record), living culture ZHKUCC 24-0161, other living culture ZHKUCC 24-0162.
GenBank numbers: ZHKUCC 24-0161: ITS – PV578244, LSU – PV578412, rpb2 – PV595358, tef1-α – PV608892; ZHKUCC 24-0162: ITS – PV578245, LSU – PV578413, rpb2 – PV595359, tef1-α – PV608893.
Notes: Two collections from our study clustered with P. hydei (CGMCC 3.28684 ex-type, and UESTCC 23.0502) in the phylogenetic tree with 99% ML bootstrap support and 1.00 BYPP value (Fig 51). The nucleotide differences, (excluding gaps), between our isolate (ZHKUCC 24-0161) and P. hydei (CGMCC 3.28684) are: ITS: 0.21% (1/476 base pairs), tef1-α: 0.84% (7/834 base pairs), and LSU 100% same. Our collection is similar to P. hydei in conidial morphology and conidiogenous cells characters (Du et al. 2025a). Based on phylogenetic placement and morphological variations, we identify our isolate as P. hydei. Pseudoteichospora hydei was described by Du et al. (2025a) from dead twigs of Arundina graminifolia from China. This is the first report of P. hydei from Borassus flabellifer.
Tetraplosphaeriaceae Kaz. Tanaka & K. Hiray, Stud. Mycol. 64: 177 (2009)
Tetraploa Berk. & Broome, Ann. Mag. nat. Hist., Ser. 2 5: 459 (1850)
Berkeley and Broome (1850) established Tetraploa with Te. aristata as the type species. Although Tanaka et al. (2009) redefined Tetraploa as Tetraploasphaeria based on its massarina-like sexual morph and Tetraploa sensu stricto asexual morphs, Hyde et al. (2013) reinstated Tetraploa over Tetraplosphaeria, which is currently accepted (Hyde et al. 2024c). Tetraploa is a holomorphic genus with the asexual morph characterized by brown conidia that are euseptate, short cylindrical with 3–4 columnar conidial body, and coarsely verrucose bases having setose appendages at the apex. The sexual morph is characterized by globose to subglobose ascomata, cylindrical to clavate asci, narrowly fusiform, and uniseptate ascospores with an appendage-like sheath (Tanaka et al. 2009, Hyde et al. 2013, 2020b, Dong et al. 2020, Jayawardena et al. 2022). Tanaka et al. (2009) proposed Tetraplosphaeria to include Tetraploa species, based on morphology and SSU and LSU phylogeny. However, Hyde et al. (2013) reinstated Tetraploa based on morphology and combined LSU, SSU, tef1-α and rpb2 phylogenetic analysis. Subsequently, phylogenetic studies mainly used LSU, SSU, ITS, tef1-α and tub2 or rpb2 instead of tub2 in species delineation (Dong et al. 2020, Hyde et al. 2020b, Jayawardena et al. 2022, Liao et al. 2024, Zhang et al. 2024, Zhao et al. 2024). In the present study, ITS, LSU, SSU, tub2 and tef1-α sequence data were employed to update Tetraploa phylogeny (Fig. 53). Currently, 38 epithets are listed under Tetraploa (Index Fungorum, 2025 July), with 24 species associated with molecular data. Seven species (about 18% of the species in this genus) have been reported from palms, including the new species described in this study (Supplementary Table 1).
Tetraploa borassi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 54
Index Fungorum number: IF 904928; Facesoffungi number: FoF 19231
Etymology: Refers to the host genus Borassus, from which the species was collected.
Saprobic on dead petiole of Borassus flabellifer. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, effuse. Mycelium superficial, composed of hyaline, smooth, septate, branched hyphae. Conidiophores absent. Conidiogenous cells indistinct. Conidia 25–35 × 10–20 μm (x̅ = 29 × 16.5 μm, n = 25), obovate to short cylindrical, with truncate to obtuse basal end, brown to dark brown, verruculose, inconspicuously euseptate, composed of 3–4 columns when mature, 2–3-septate in each column, with 2–4 appendages. Appendage 55–200 μm long (x̅ = 121.5 μm, n = 20), 5–7.5 μm wide at the base, 3–4 μm wide at the apex, pale brown, euseptate, smooth, straight, rigid.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, dense, grey, flossy, velvety; reverse centre dark brown to orange-brown, turning white towards the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, Xishuangbanna Dai Nationality Park, on dead petiole of Borassus flabellifer, 6 Feb 2023, Y.R. Xiong and L. Lu, XG248 (MHZU 23-0179, holotype), ex-type ZHKUCC 24-0165, other ex-type living culture ZHKUCC 24-0166.
GenBank numbers: ZHKUCC 24-0165: ITS – PV578258, LSU – PV578426, SSU – PV578554, tef1-α – PV608896, tub2 – PV607968; ZHKUCC 24-0166: ITS – PV578259, LSU – PV578427, SSU – PV578555, tef1-α – PV608897, tub2 – PV607969.
Notes: In the multigene phylogenetic analysis, two collections from this study clustered with Tetraploa clade in Tetraplosphaeriaceae and formed a sister lineage to T. wurfbainiae with 100% ML bootstrap support and 1.00 BYPP value (Fig. 53). The nucleotide differences (excluding gaps) between T. borassi (ZHKUCC 24-0165) and T. wurfbainiae (ZHKUCC 23-0954) were checked and given as follows: ITS: 2.67% (13/487 base pairs), LSU: 1.38% (12/868 base pairs), tub2: 4.56% (27/592 base pairs), and tef1-α: 4.06% (11/271 base pairs). Morphologically, T. borassi has verruculose conidia, a feature which is not observed in T. wurfbainiae (Liao et al. 2024). Moreover, conidia of T. borassi have 2–3-septate columns with 2–4 appendages, while T. wurfbainiae have 3-4-septate or sometimes 5-septate columns in the conidia with one (in young conidia) or three appendages (Liao et al. 2024). Based on phylogenetic placement and morphological variations, we introduce T. borassi as a new species.
Pleosporales genera incertae sedis
Inflatispora Y. Zhang ter, J. Fourn. & K.D. Hyde, Sydowia 62: 290 (2011)
Inflatispora licualae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 56
Index Fungorum number: IF 904929; Facesoffungi number: FoF 19232
Etymology: Refers to the host genus Licuala, from which the species was collected.
Saprobic on a dead segment of Licuala sp. Asexual morph: Hyphomycetous. Colonies on natural substrates effuse, hairy, scattered, hyaline to pale brown, with glistening conidial masses at apex. Mycelium immersed, composed of hyaline, smooth, septate, pale brown to hyaline hyphae. Conidiophores 50–60 × 3.5–4 μm (x̅ = 53 × 3.8 μm, n = 25), macronematous, mononematous, erect, solitary, straight or slightly flexuous, cylindrical, smooth-walled, septate, unbranched, dark brown or mid brown, becoming narrow towards the apex. Conidiogenous cells 4.5–8.5 × 1.5–2 μm (x̅ = 6.6 × 1.9 μm, n = 25), monophialidic, integrated, terminal, hyaline, smooth-walled. Conidia 4–5 × 1.5–2 μm (x̅ = 4.7 × 1.8 μm, n = 40), acrogenous, aggregated in slimy masses, oblong to ellipsoidal, hyaline, aseptate, smooth-walled, guttulate at both ends. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface, curled; in reverse yellow in the middle and white at the margin.
Known distribution: Thailand (this study).
Material examined: Thailand, Narathiwat, Toh Daeng Peat Swamp Forest, on dead segment of Licuala sp., 5 Aug 2024, Y.R. Xiong, XG350 (MFLU 25-0155, holotype); ex-type MFLUCC 25-0220, other ex-type living culture MFLUCC 25-0221.
GenBank numbers: MFLUCC 25-0220: ITS – PV578190, LSU – PV578354, SSU – PV578506, rpb2 – PV595330; MFLUCC 25-0221: ITS – PV578191, LSU – PV578355, SSU – PV578507, rpb2 – PV595331.
Eurotiomycetes O.E. Erikss. & Winka
Chaetothyriales M.E. Barr, Mycotaxon 29: 502 (1987)
Herpotrichiellaceae Munk, Dansk botanisk Arkiv 15 (2): 131 (1953)
Cladophialophora Borelli, Proceedings of the 5th International Conference on Mycoses: 355 (1980)
Cladophialophora is a genus with diverse ecological roles, functioning as opportunistic pathogens or pathogens in plants, animals, and humans, as well as existing as saprobes and endophytes (de Hoog et al. 2007, Crous et al. 2007, Badali et al. 2008, Feng et al. 2014). Borelli (1980) established Cladophialophora with C. carrionii (= C. ajelloi) as the type species to accommodate species that exhibit spore formation resembling Cladosporium and conidiogenous cells similar to Phialophora (Borelli 1980, Badali et al. 2008, Bensch et al. 2012). Cladophialophora is characterized by 1-celled, globose to elongate, dry conidia arising through blastic, acropetal conidiogenesis, most are arranged in branched chains, as melanized conidia with inconspicuous scars (Borelli 1980, Ho et al. 1999, de Hoog et al. 2000, Badali et al. 2008). Based on morphology and SSU phylogeny, Haase et al. (1999) and Untereiner (2000) accepted Cladophialophora in Chaetothyriales. Subsequent phylogenetic studies mainly used LSU, ITS or added SSU, tub2 and tef1-α (Crous et al. 2007, de Hoog et al. 2007, Diederich et al. 2013, Boonmee et al. 2021, Torres-Garcia et al. 2023, Chang et al. 2023), and in this study, we used ITS, LSU, SSU, tub2 and tef1-α to update Cladophialophora phylogenetic tree (Fig. 57). Currently, 70 epithets are listed under Cladophialophora (Index Fungorum, 2025 July), with 65 species associated with molecular data. Three species (about 5% of the species in this genus) have been reported from palms, including a new species described in this study (Supplementary Table 1).
Cladophialophora licualae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 58
Index Fungorum number: IF 904930; Facesoffungi number: FoF 19233
Etymology: Refers to the host genus Licuala, from which the species was collected.
Saprobic on dead petiole of Licuala sp. Asexual morph: Hyphomycetes. Colonies on natural substrate effuse, scattered, brown to dark brown, hairy. Mycelium is superficial and immersed, composed of branched, septate, smooth-walled, pale brown to brown hyphae. Conidiophores 40–120 × 4–7 µm (x̅ = 71.5 × 5.3 µm, n = 20), macronematous, mononematous, dark brown to brown, septate, single or caespitose, straight or flexuous, unbranched, smooth, and cylindrical. Conidiogenous cells 10–15 × 4–5 µm (x̅ = 13.2 × 4.7 µm, n = 20), brown to pale brown, monoblastic, integrated, determinate, terminal, cylindrical. Conidia (15–)20–40 × 4–5.5 µm (x̅ = 28 × 4.8 µm, n = 30), solitary, easy to dry, cylindrical, elongate, pale brown, concolorous, slightly thickened walls and septa, 3–7-septate, cells vary in size, apex rounded, basal cell truncate and elongate-conical. Sexual morph Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, umbonate, with fluffy, dense, white mycelium on the surface with entire margin; in reverse black in the middle and white at the margin.
Known distribution: Thailand (this study).
Material examined: Thailand, Narathiwat Province, Toh Daeng Peat Swamp Forest, on dead petiole of Licuala sp., 4 Aug 2023, Y.R. Xiong, XG327 (MFLU 25-0146, holotype), ex-type MFLUCC 25-0202, other ex-type living culture MFLUCC 25-0203.
GenBank numbers: MFLUCC 25-0202: ITS – PV578148, LSU – PV578318, tub2 – PV584055, tef1-α – PV608826; MFLUCC 25-0203: ITS – PV578149, LSU – PV578319, tub2 – PV584056, tef1-α – PV608827.
Notes: Two collections clustered in Cladophialophora clade and formed a sister lineage to C. Matsushimae in the phylogenetic tree with 100% ML bootstrap support and 1.00 BYPP (Fig. 57). The nucleotide differences (excluding gaps) between C. Licualae (MFLUCC 25-0202) and C. Matsushimae (MFC 1P384) were checked and given as follows: ITS: 5.41% (30/555 base pairs), and LSU: 0.91% (6/658 base pairs). Morphologically, C. licualae has 3–7-septate cylindrical to elongate conidia, which are not Cladophialophora-like morphs (Feng et al. 2014). In addition, conidia of C. matsushimae are in branched chains, 0–1(–2)-septate and smaller “microconidia”, oval to broadly fusiform, 0–1-septate, are produced (Koukol 2010, Kularathnage et al. 2025). Based on the phylogenetic placement and morphological variations, we introduce C. licualae as a new species.
Veronaea Cif. & Montemart., Atti Ist. bot. Univ. Lab. crittog. Pavia, Ser. 4 15: 68 (1957)
Ciferi & Montemartini (1957) established Veronaea and typified it with V. botryose. Veronaea is known from its asexual morph and characterized by erect, mostly unbranched, pale to medium brown conidiophores with polyblastic, sympodial, terminal or intercalary, and cylindrical conidiogenous cells and conidia which are smooth-walled, septate, cylindrical to pyriform and pale brown to brown (Papendorf 1976, Arzanlou et al. 2007, Rambelli 2011, Zhang 2019). Based on morphological and phylogenetic analyses of combined ITS and LSU sequences, Arzanlou et al. (2007) redefined Veronaea. Subsequently, most phylogenetic studies used ITS, LSU and SSU or add tub2 for species delineation (Dong et al. 2018, Chandrasiri et al. 2021, Yang et al. 2023b, Su et al. 2023). In this study, we used ITS, LSU, SSU and tub2 to update Veronaea phylogeny (Fig. 59). Currently, 21 epithets are listed under Veronaea (Index Fungorum, 2025 July), and only five species have molecular data. Here in we describe a new species which is the first report of Veronaea from a palm (Supplementary Table 1).
Veronaea pinangae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 60
Index Fungorum number: IF 904931; Facesoffungi number: FoF 19234
Etymology: Refers to the host genus Pinanga, from which the species was collected.
Saprobic on dead rachis of Pinanga riparia. Asexual morph: Hyphomycetous. Colonies on the natural substrate, effuse, widely spreading, superficial, scattered, hairy, brown to dark brown. Conidiophores 160–180 × 5–6 μm (x̅ = 167 × 5.6 μm, n = 10), macronematous, mononematous, solitary, unbranched, straight with irregularly twisted, smooth to slightly roughened, cylindrical, brown to dark brown. Conidiogenous cells 20–23 × 5–6 μm (x̅ = 22 × 5.5 μm, n = 25), monoblastic, integrated, sympodial, terminal, cylindrical or fertile at the apex of conidiophores, brown to hyaline, irregular inclusion. Conidia 18–20 × 5–7 μm (x̅ = 18.8 × 6.2 μm, n = 25), solitary, acropleurogenous, elliposoid to fusiform, 3–5-septate, smooth, tapering to a pointed apex and truncate at base, pale brown. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, raised, fluffy, dense, convex or dome-shaped, with dark-brown papillate surface, brown in the centre, lighter on the outside, dark-brown at the margins, consistently dark-brown in reverse.
Known distribution: Thailand (this study).
Material examined: Thailand, Narathiwat Province, on an unidentified beach, on dead rachis of Pinanga riparia, 6 Aug 2023, Y.R. Xiong, XG341 (MFLU 25-0151, holotype), ex-type MFLUCC 25-0212, other ex-type living culture MFLUCC 25-0213.
GenBank numbers: MFLUCC 25-0212: ITS – PV578268, LSU – PV578436, tub2 – PV607970; MFLUCC 25-0213: ITS – PV578269, LSU – PV578437, tub2 – PV607971.
Notes: our collection formed a sister lineage with Veronaea botryosa in the phylogenetic tree with 100% ML bootstrap support and 1.00 BYPP (Fig. 59). The nucleotide differences (excluding gaps) between V. pinangae (MFLUCC 25-0212) and V. botryosa (CBS 102593) were checked and given as follows: ITS: 5.52% (34/616 base pairs), LSU: 1.12% (10/895 base pairs), and tub2: 11.83% (44/372 base pairs). Morphologically, V. pinangae has 3–5-septate conidia that taper to a pointed apex and are truncate at the base, while V. botryose conidia are rounded at the apex and (0–)1–2(–3) septate (Bonifaz et al. 2013, Dong et al. 2018). Based on phylogenetic placement and morphological variations, we introduce V. pinangae as a new species.
Sclerococcales Réblová, Unter. & W. Gams, Mycological Progress 16 (1): 34 (2016)
Dactylosporaceae Bellem. & Hafellner, Cryptog. Mycol. 3: 79 (1982) (=Sclerococcaceae Réblová, Unter. & W. Gams)
Sclerococcum Fr., Novitiae forae svecicae 5 (2): 79 (1819)
Fries (1819, 1825) established Sclerococcum with S. sphaerale (synonym: Spiloma sphaerale) as the type species. Sclerococcum is a holomorphic genus which is asexually characterized by conidiomata that are blackish and sporodochial-stromatic, with conidiogenesis being thallic, probably meristem thallic (meristem arthric) (Kiffer & Morelet 2000, Seifert et al. 2011), and conidia are dark brown, ranging from uni- to multi-cellular (Diederich et al. 2013, Miadlikowska et al. 2014). The sexual morph is characterized by superficial to stalked blackish apothecia, with an excipulum composed of textura angularis to globulosa cells, hymenium featuring a thick gelatinous matrix, and the paraphyses are sparingly branched, with apices that are slightly swollen and pigmented. Asci are cylindrical to clavate, amyloid with an I-tholus, and are covered by an I+ blue external gelatinous cap. Ascospores are subglobose to ellipsoid, 8-spored, with spores having one to several transverse septa (Bellemère & Hafellner 1982, Döbbeler & Buck 2017, Hafellner 1979). Diederich et al. (2013, 2018) re-circumscribed Sclerococcum based on morphological evidence and phylogenetic analysis of combined ITS, LSU and LSU, and mtSSU. Subsequently, phylogenetic studies mainly used SSU, mtSSU, LSU and ITS or excluded SSU and mtSSU (Ekanayaka et al. 2019b, Thiyagaraja et al. 2022, Ma et al. 2024). We used ITS, LSU, and SSU to update phylogenetic analyses of Sclerococcum (Fig. 61). Currently, 105 epithets are listed under Sclerococcum (Index Fungorum, 2025 July), and 19 species are supported by molecular data. Among these, four species (3.77%) have been reported from palms, including the new species described in this study (Supplementary Table 1).
Sclerococcum caryotae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 62
Index Fungorum number: IF 904932; Facesoffungi number: FoF 19235
Etymology: Refers to the host genus Caryota, from which the species was collected.
Saprobic on dead rachis of Caryota mitis. Asexual morph: Not observed. Sexual morph: Ascomata 360–670 × 130–250 μm (x̅ = 476 × 190 μm, n = 10), apothecia, superficial, scattered, composed of a disc usually sitting on a distinct stipe, not clearly differentiated from the disc; disc shiny, black when dry, dark brown and somewhat translucent when wet, epruinose, round, plane to somewhat concave. Stipe 70–140 μm wide, usually somewhat tapering towards the base, pale to medium brown, much paler than the disc or occasionally concolourous dark brown cells of textura angularis to globulosa. Hymenium hyaline, enclosed in a thick gelatinous matrix. Pseudoepithecium composed of hyaline to brown amorphous matter surrounding the paraphysis tips. Paraphyses 1.5–2 μm wide, numerous, cylindrical, hyaline. Asci 40–50 × 8–9.5 μm (x̅ = 45 × 8.7 μm, n = 25), 8-spored, unitunicate, short sessile, cylindric-clavate, rounded at the apex. Ascospores 13–15.5 × 3.5–5 μm (x̅ = 13.9 × 4.3 μm, n = 25), biseriate, hyaline or light brown, brown when old, homopolar to heteropolar (with a longer upper cell), ellipsoid to slightly obovate, occasionally oblong, straight or occasionally slightly curved, 1-septate, not or occasionally slightly constricted at the septum, guttulate, smooth.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, lobate, with fluffy, dense, yellow in the centre, white mycelium on the surface with entire margin; in reverse yellow in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead rachis of Caryota mitis, 5 Feb 2023, Y.R. Xiong and L. Lu, XG204 (MHZU 23-0159, holotype), ex-type ZHKUCC 24-0125, other ex-type living culture ZHKUCC 24-0126.
GenBank numbers: ZHKUCC 24-0125: ITS – PV578250, LSU – PV578418, SSU – PV578548; ZHKUCC 24-0126: ITS – PV578251, LSU – PV578419, SSU – PV578549.
Notes: Two collections formed a separate lineage within Sclerococcum in the phylogenetic tree with 81% ML bootstrap support and 0.99 BYPP value (Fig. 61). Based on a MegaBLAST (Query cover ≥ 70%) search using the LSU sequence, the closest matches in NCBIs GenBank nucleotide database were S. pseudobactrodesmium (GenBank OR514702; similarity 807/842 (95.84%), 5 gaps), S. parasiticum (GenBank MH698500; similarity 799/835 (95.69%), 3 gaps) and S. simplex (GenBank MZ655912; similarity 807/846 (95.39%), 5 gaps). The highest similarities using the SSU sequence were S. parasiticum (GenBank MK759888; similarity 588/596 (98.66%), 0 gaps) and S. pseudobactrodesmium (GenBank OR604485; similarity 588/597 (98.49%), 1 gap). Morphologically, S. caryotae is distinct in Sclerococcum by 1-septate homopolar to heteropolar ascospores. Based on phylogenetic placement and morphological variations, we introduce S. caryotae as a new species.
Leotiomycetes O.E. Erikss. & Winka
Helotiales Nannf., Nova Acta Regiae Soc. Sci. Upsal. Ser. 4, 8 (2): 68 (1932)
Lachnaceae Raitv., Scripta Mycologica Tartu 20: 7 (2004)
Proliferodiscus J.H. Haines & Dumont, Mycologia 75: 536 (1983)
Proliferodiscus is a discomycete genus and was established by Haines & Dumont (1983) to accommodate species with proliferous hymenial discs, including P. inspersus (type) and P. earoleuca (Haines & Dumont 1983). The genus is characterized by proliferous apothecia with a short stipe, hyaline, thin-walled, curled hair that are densely granulated or covered by hyaline, amorphous material, an ectal excipulum composed of textura prismatica cells, filiform paraphyses, asci are 8-spored, and ascospores are hyaline (Haines & Dumont 1983, Ekanayaka et al. 2019a, Luo et al. 2025). The only known asexual morph in this genus is from P. ingens, which has subglobose conidiomata, hyaline, septate, smooth-walled conidiophores, and cylindrical to ellipsoidal, hyaline, aseptate conidia (Bien & Damm 2020). Proliferodiscus species are primarily distributed in America, Asia, Australia, and Europe (Bien & Damm 2020, Li et al. 2022). In this study, ITS and LSU sequences were employed to update the phylogenetic tree of Proliferodiscus (Fig. 63). There are 14 species accepted in Proliferodiscus (Index Fungorum, 2025 July), and 11 species are verified with DNA sequences (Li et al. 2022, Luo et al. 2025). Two species (about 15% of the species in this genus) have been reported from palms (Supplementary Table 1), including a new host and distribution record for P. chiangraiensis, introduced from Livistona chinensis in China, in this study.
Proliferodiscus chiangraiensis Ekanayaka & K.D. Hyde, Mycosphere 10 (1): 403 (2019). Fig. 64
Index Fungorum number: IF 556293; Facesoffungi number: FoF 05912
Saprobic on dead segment of Livistona chinensis. Asexual morph: Coelomycetous. Stromatic conidiomata 120–180 × 180–250 µm (x̅ = 148.6 × 216.5 µm, n = 20), solitary or aggregated, subglobose or irregular, unilocular, semi-immersed, dark brown to black, almost glabrous, opening with an irregular rupture. Peridium 30–50 µm (x̅ = 36.2 µm, n = 20), composed of thick-walled, hyaline to brown cells of textura intricata. Paraphyses 1–1.8 µm (x̅ = 1.3 µm, n = 20), filiform, unbranched, hyaline and aseptate. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 7–10 × 1–2.5 µm (x̅ = 9.2 × 1.7 µm, n = 20), enteroblastic, hyaline, smooth-walled, navicular to subulate, or cylindrical, tapering towards apices, collarettes hardly visible, periclinal thickening sometimes visible. Conidia 2.5–3.5 × 1.2–1.8 (x̅ = 3.0 × 1.5 µm, n = 20), hyaline, smooth-walled, aseptate, cylindrical to ellipsoidal, straight, with both ends rounded, guttulate. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 1–2 cm diam., at 25 °C, slight raised, with lobate margin, cottony or floccose, light brown pigment or exudate accumulates at the colony center, above white, yellowish in reverse.
Known distribution: Thailand (Ekanayaka et al. 2019a), China (this study).
Material examined: China, Jiangxi Province, Nanchang City, Meiling National Forest Park, on a dead segment of Livistona chinensis, 10 April 2024, Y.R. Xiong, XG425 (MHZU 24-0513, new host and geography record), living culture ZHKUCC 25-0073, other living culture ZHKUCC 25-0074.
GenBank numbers: ZHKUCC 25-0073: ITS – PV578232, LSU – PV578398, rpb2 – PV595352; ZHKUCC 25-0074: ITS – PV578233, LSU – PV578399, rpb2 – PV595353.
Notes: Two collections obtained in this study developed a sister clade with P. chiangraiensis (MFLU 16-0588, holotype) by 75% ML bootstrap support and 0.90 BYPP (Fig. 63). The nucleotide differences (excluding gaps) between our collection (ZHKUCC 25-0073) and P. chiangraiensis (MFLU 16-0588) were checked and shown - ITS: 1.1% (6/523 base pairs), LSU: 0.5% (4/867 base pairs), and SSU: 1.6% (14/844 base pairs). Proliferodiscus chiangraiensis was introduced by Ekanayaka et al. (2019a) based on only the sexual morph. Our collection exhibits only an asexual morph. Our species exhibits characteristics consistent with the asexual morph of Proliferodiscus, particularly the presence of enteroblastic and cylindrical conidiogenous cells, as well as cylindrical to ellipsoidal, hyaline, and aseptate conidia (Bien & Damm 2020, Fig. 64). Therefore, based on morphology and phylogenetic analysis, we identified our collection as P. chiangraiensis new host and geographical record for P. chiangraiensis. It represents the asexual morph of P. chiangraiensis. In addition, our collection is the first asexual morph of P. chiangraiensis.
Orbiliomycetes O.E. Erikss. & Baral
Orbiliales Baral, O.E. Erikss., G. Marson & E. Weber
Orbiliaceae Nannf., Nova Acta Regiae Societatis Scientiarum Upsaliensis 8 (2): 250 (1932)
Orbilia Fr., Corpus Florarum provincialium suecicae I. Floram Scanicam: 343 (1836)
Fries (1836) introduced Orbilia with O. xanthostigma as the type species. Baral et al. (2020) listed three subgenera (Hemiorbilia, Habrostictis, and Orbilia) within Orbilia, based on morphology and phylogeny inferred from SSU, ITS, and LSU. Orbilia is a holomorphic subgenus characterized by hydrated apothecia being mainly whitish, ochraceous, yellowish, rose, orange, lilaceous, margin glabrous or crenulate, denticulate to dentate, or hairy, and sessile or (short-)stipitate. Ascus apex is slightly or medium, or strongly truncate, not or slightly to distinctly indented, thin-walled, rarely with a dome, and sometimes with an apical chamber. Ascospores are variously shaped, globose to tear-shaped, subulate, rod-shaped, plug-shaped, dumbbell-shaped or ampulliform, and filum absent or very short. Paraphyses are apically uninflated to strongly capitate-clavate, and also spathulate to lanceolate (Baral et al. 2020). The asexual morph is characterized by unbranched conidia that vary in shape between ellipsoid, sub-cylindrical, clavate, obovoid, obpyramidal, fusiform, or top-shaped, with mostly septate, either 1-septate (didymosporous) or with more septa (phragmosporous), and rarely non-septate (amerosporous). Conidia are branched (staurosporous) always multiseptated with one stipe and two, three, or four arms, and are mainly Y- or T-shaped, more rarely ┼-, H-, Κ-, U-, V- or tuning fork-shaped, thereby forming either 2- (flat) or 3-dimensional (spatial) structures, straight or curved (Baral et al. 2020). In this study, we used ITS and LSU to update the phylogeny of Orbilia (Fig. 65). Currently, 27 species are listed under Orbilia in a narrow sense (Baral et al. 2020), and all are supported by molecular data. Nine species (about 32% of the species in this genus) have been reported from palms, including a new species described in this study (Supplementary Table 1).
Orbilia phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 66
Index Fungorum number: IF 904933; Facesoffungi number: FoF 19236
Etymology: Refers to the host genus Phoenix, from which the species was collected.
Saprobic on dead leaf sheath of Phoenix sylvestris. Asexual morph: Hyphomycetous. Colonies on natural substratum superficial, effuse, erect, cylindrical or tufted, yellowish to pale ochre. Mycelium immersed. Conidiophores 3.5–4.5 μm wide, synnematous, semi-macronematous, scattered, erect, rarely gregarious, unbranched, hyaline, septate, smooth. Conidiogenous cells 7–12 × 2–4 μm (x̅ = 9.6 × 2.8 μm, n = 25), monoblastic, sympodial, obclavate, hyaline. Hyphopodium 10–15 × 4–5 μm (x̅ = 13.5 × 4.8 μm, n = 25), 2–3-septate when mature, brown, oblong, rounded at apex. Conidia 14–20 × 7.5–8.5 μm (x̅ = 17 × 8 μm, n = 25), (total size), U-shaped, stalk-like nodulous protuberance, the two arms ± equal in length, parallel, arms 12–15 × 4–5 μm (x̅ = 13.8 × 4.8 μm, n = 25), cylindrical but slightly tapering above, 1–3-septate (each arm with an oblique basal septum). Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, flat, filamentous, dense, white mycelium on the surface with entire margin; in reverse cream.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Ganzhou City, Xingda Restaurant, on dead leaf sheath of Phoenix sylvestris, 9 Apr 2024, Y.R. Xiong, XG364 (MHZU 24-0457, holotype), ex-type ZHKUCC 25-0021, other ex-type living culture ZHKUCC 25-0022.
GenBank numbers: ZHKUCC 25-0021: ITS – PV578218, LSU – PV578384; ZHKUCC 25-0022: ITS – PV578219, LSU – PV578385.
Notes: Two collections formed a separate lineage and clustered with Orbilia eucalypti in the phylogenetic tree with 100% ML bootstrap support and 1.00 BYPP (Fig. 65). The nucleotide differences (excluding gaps) between O. phoenicis (ZHKUCC 25-0021) and O. eucalypti (GXU1484), were checked and given as ITS: 5.05% (24/475 base pairs), and LSU: 2.24% (12/535 base pairs). Morphologically, O. phoenicis is distinct by 2–3-septate and brown hyphopodium from O. eucalypti (GXU1484) (Shao et al. 2018). Moreover, O. phoenicis has 1–3-septate conidia arms (each arm with an oblique basal septum) while O. eucalypti (GXU1484) has 1–2 septate conidia arms (each arm with an oblique basal septum) (Shao et al. 2018). Based on phylogenetic placement and morphological variations, we introduce O. phoenicis as a new species.
Sordariomycetes O.E. Erikss. & Winka
Chaetosphaeriales Huhndorf, A.N. Mill. & F.A. Fernández, Mycological Research 108 (12): 378 (2004)
Chaetosphaeriaceae Réblová, M.E. Barr & Samuels, Sydowia 51: 56 (1999)
Codinaeella Réblová & Hern.-Restr., Journal of Fungi 7 (12, no. 1097): 45 (2021)
Codinaeella plagiogyriae J.Y. Zhang & Y.Z. Lu, Fungal diversity 132:349 (2025). Fig. 68
Index Fungorum number: IF 903193; Facesoffungi number: FoF 17045
Saprobic on dead segment of Livistona chinensis. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, effuse, white to yellowish, dense, shining, globose, aggregated in a large mass. Mycelium mostly immersed, composed of hyaline hyphae, branched, septate, smooth-walled. Conidiophores 80–120 × 4.5–5.5 µm (x̅ = 97.2 × 4.9 µm, n = 20), macronematous, mononematous, single or in small groups, erect, straight or slightly flexuous, smooth-walled, dark brown at the base, becoming paler to subhyaline towards the apex, 3–8-septate, smooth, guttulate. Conidiogenous cells 15–25 × 3–5 (x̅ = 19.4 × 3.7 µm, n = 20), mono- or polyphialidic, with discrete, lateral phialides, integrated, terminal, with lateral openings formed by successive sympodial elongation, cylindrical to cylindrical-lageniform, with funnel-shaped collarettes, light brown at the base and becoming subhyaline to hyaline towards the apex, smooth-walled. Conidia 15–20 × 3–4.5 µm (x̅ = 18.1 × 3.7 µm, n = 20), falcate, asymmetrical, tapering toward both ends, aseptate, aggregated in large and slimy mass, smooth-walled, hyaline, with a straight or gently curved setula at both ends, 7–8µm long. Sexual morph: Not observed.
Known distribution: China (Zhang et al. 2025, this study).
Material examined: China, Jiangxi Province, Nanchang City, Meiling National Forest Park, on dead segment of Livistona chinensis, 10 April 2024, Y.R. Xiong, XG380 (MHZU 24-0461, new host record), living culture ZHKUCC 25-0039, other living culture ZHKUCC 25-0040.
GenBank numbers: ZHKUCC 25-0039: ITS – PV578150, LSU – PV578320; ZHKUCC 25-0040: ITS – PV578151, LSU – PV578321.
Notes: Two collections obtained in this study clustered with C. plagiogyriae (KUNCC 23-14050, ex-type) by 97% ML bootstrap support and 1.00 BYPP (Fig. 67). Based on a MegaBLAST (Query cover ≥ 70%) search using the ITS and LSU sequence, the closest matches in the NCBI GenBank nucleotide database were C. plagiogyriae (GenBank PQ671254; similarity 498/498(100%), 0 gap) for ITS; C. plagiogyriae (GenBank PQ671174; similarity 882/884(99%), 2 gaps) for LSU. Codinaeella plagiogyriae was introduced by Zhang et al. (2025) and was collected from dead fronds and frond stalks of Plagiogyria euphlebia in China. Morphological evidence of conidiophores and conidia fits with the holotype descriptions of C. plagiogyriae (Zhang et al. 2025, Fig. 68). Therefore, based on morphology and phylogenetic analysis, we identified our collection as a new host record of C. plagiogyriae from Livistona chinensis.
Fusichloridium W.P. Wu & Y.Z. Diao, Fungal Diversity 116: 282 (2022)
Wu & Diao (2022) established Fusichloridium to accommodate the type species, F. cylindrosporum (Réblová et al. 2022) based on morphology, and ITS and LSU phylogenetics. Fusichloridium is a holomorphic genus with the asexual morph characterized by cylindrical and sympodially or sometimes percurrently proliferating conidiophores, monophialidic or polyphialidic with almost hyaline collarettes, and conidia are cylindrical with tapering and centrally sometimes slightly constricted (Wu & Diao 2022). The sexual morph is characterized by perithecia and subglobose ascomata, the ostiole is conical and covered with conidiophores, paraphyses are thread-like but soon evanescent, cylindrical to somewhat fusiform with a thin apical plate, and ascospores are fusiform and mostly 3-septate with guttules (Wu & Diao 2022). Subsequent phylogenetic studies mainly used SSU, LSU, ITS, and tef1-α, or did not include SSU sequence data in analyses (Réblová et al. 2022). Following Réblová et al. (2022), we used ITS and LSU to update phylogenetic studies for Fusichloridium (Fig. 69). Only one species is listed under Fusichloridium (Index Fungorum, 2025 July), and it has molecular data. This is the first report of Fusichloridium on a palm (Supplementary Table 1).
Index Fungorum number: IF 904934; Facesoffungi number: FoF 19237
Etymology: Refers to the host genus Licuala, from which the species was collected.
Saprobic on dead leaf sheath of Licuala sp. Asexual morph: Hyphomycetous. Colonies on natural substrate, superficial, effuse, hairy, with white and gold shining masses on the apex of conidiophores. Mycelium partly immersed, composed of septate, hyaline hyphae. Conidiophores 100–200 × 5–6.5 μm (x̅ = 144 × 5.5 μm, n = 25), macronematous, mononematous, erect, straight or slightly flexuous, solitary, scattered, smooth, septate, brown, with percurrent proliferations assuming a geniculate appearance. Conidiogenous cells 20–60 × 5–7 μm (x̅ = 45 × 5.7 μm, n = 25), mono- to poly-phialidic, terminal, integrated, cylindrical, brown, with subhyaline funnel-shaped collarettes, narrow below the collarette. Conidia 17–23 × 5–8 μm (x̅ = 20 × 6.9 μm, n = 25), accumulating in slimy beige to pale brown heads, elongate mouse-shaped with tapering, centrally sometimes slightly constricted, one inconspicuous medium septum, hyaline when young, yellow-brown when mature, truncate base, appendage at apex; basal cushion subulate to narrowly lageniform 2–5 × 1.5–2 μm (x̅ = 3 × 1.9 μm, n = 25), with filiform-like appendage up to 170 μm long. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 2 cm diam., at 25 °C, circular, umbonate, with fluffy, dense, grey mycelium on the surface with undulate margin; in reverse yellow in the middle and cream at the margin.
Known distribution: Thailand (this study).
Material examined: Thailand, Narathiwat Province, Toh Daeng Peat Swamp Forest, on dead leaf sheath of Licuala sp., 4 Aug 2023, Y.R. Xiong, XG326 (MFLU 25-0145, holotype), ex-type MFLUCC 25-0200, other ex-type living culture MFLUCC 25-0201.
GenBank numbers: MFLUCC 25-0200: ITS – PV578182, LSU – PV578346; MFLUCC 25-0201: ITS – PV578183, LSU – PV578347.
Notes: Two collections formed a separate lineage, but both are close to Chaetosphaeria obovoidea and Fusichloridium cylindrosporum in the phylogenetic tree with 100% ML bootstrap support and 0.91 BYPP value (Fig. 69). The nucleotide differences (excluding gaps) between F. licualae (MFLUCC 25-0200) and its phylogenetically related species were checked and given as follows: Chaetosphaeria obovoidea (GZCC 22-0085) - ITS: 5.15% (25/485 base pairs), and LSU: 3.05% (28/918 base pairs); Fusichloridium cylindrosporum (CBS 101429) - ITS: 6.65% (34/511 base pairs), and LSU: 3.66% (34/930 base pairs). Our collections have terminal conidiogenous cells and conidia elongate mouse-shaped with tapering which is distinct from Chaetosphaeria obovoidea which has aseptate and obovoid conidia with intercalary conidiogenous loci (Zhang et al. 2022, Fig. 70). In addition, our collections have long filiform-like appendages with basal cushions which are absent in Fusichloridium cylindrosporum (Réblová & Gams 1999, Réblová et al. 2022, Fig. 70). Our collections are similar to Fusichloridium by having conidia that are sometimes centrally slightly constricted (Wu & Diao 2022, Fig. 70). Together with phylogenetic placement, we introduce our collection as a new species F. licualae. Moreover, we propose that Chaetosphaeria obovoidea can be synomized in Fusichloridium based on the phylogenetic analysis results. However, it required more collections and evidence to support this.
Rattania Prabhug. & Bhat, Mycotaxon 108: 218 (2009)
Prabhugaonkar & Bhat (2009) established Rattania with R. setulifera as the type species. Rattania is a hyphomycetous genus characterized by sporodochia with setose conidiomata, monoblastic conidiogenous cells and aseptate to multi-septate, and setulate conidia (Prabhugaonkar & Bhat 2009). Shenoy et al. (2010) placed Rattania in Chaetosphaeriales based on morphological evidence and phylogenetic analysis using LSU. Subsequently, phylogenetic studies mainly used ITS and LSU for analysis (Calabon et al. 2021). We used ITS and LSU to update phylogenetic analyses of Rattania (Fig. 71). Four species are listed under Rattania (Index Fungorum, 2025 July), and all have molecular data. Two species (40% of the species in this genus) have been reported from palms, including a new species described in this study (Supplementary Table 1).
Rattania pinangae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 72
Index Fungorum number: IF 904935; Facesoffungi number: FoF 19238
Etymology: Refers to the host genus Pinanga, from which the species was collected.
Saprobic on dead leaf sheath of Pinanga riparia. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, scattered. Mycelium mostly immersed, composed of branched, septate, smooth, thin-walled, brown hyphae. Conidiomata sporodochial, scattered, punctiform, pulvinate, dark brown to black, setose, dark brown, basal stroma composed of dark brown, irregular cells. Setae 200–450 × 7–13 μm (x̅ = 361 × 9.8 μm, n = 25), sterile, arising from the lower part of the stroma, subulate, acutely pointed, mid to dark brown, becoming paler towards the apex, smooth, simple, straight or slightly curved, sometimes constricted at septa Conidiophores forming a close palisade over surface of the stroma, cylindrical, brown to pale brown. Conidiogenous cells 10–15 × 3–4 μm (x̅ = 12.4 × 3.6 μm, n = 25), integrated, terminal, monophialidic, ampulliform or cylindrical, hyaline to pale brown. Conidia 10–13 × 3–4 μm (x̅ = 11.5 × 3.4 μm, n = 25), holoblastic, solitary, hyaline, aseptate, naviculate to fusiform, curved, guttulate, with a single filiform setula at both ends, 3–5 μm long. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, brown, with fluffy, dense, white mycelium on the surface with entire margin; in reverse dark brown.
Known distribution: Thailand (this study).
Material examined: Thailand, Narathiwat Province, in an unidentified beach, on dead leaf sheath of Pinanga riparia, 6 Aug 2023, Y.R. Xiong, XG340 (MFLU 25-0150, holotype), ex-type MFLUCC 25-0210, other ex-type living culture MFLUCC 25-0211.
GenBank numbers: MFLUCC 25-0210: ITS – PV578246, LSU – PV578414; MFLUCC 25-0211: ITS – PV578246, LSU – PV578414.
Notes: Two collections from this study formed an independent lineage within Rattania in the phylogenetic tree with 88% ML bootstrap support and 1.00 BYPP (Fig. 71). Based on a MegaBLAST (Query cover ≥ 70%) search using the LSU sequence, the closest matches in NCBIs GenBank nucleotide database were R. falcata (GenBank OL655195; similarity 838/848 (98.82%), 1 gap), R. setulifera (GenBank HM171322; similarity 829/839 (98.81%), 2 gaps) and R. aquatica (GenBank OL655050; similarity 837/850 (98.47%), 0 gap). The highest similarities using the ITS sequence were Chaetosphaeriales sp. (GenBank JX243872; similarity 452/479 (94.36%), 9 gaps), Chaetosphaeriales sp. (GenBank JX243880; similarity 480/513 (93.57%), 9 gaps) and Chaetosphaeriales sp. (GenBank JX243871; similarity 479/512 (93.55%), 9 gaps). Moreover, Rattania pinangae is distinct from other known Rattania species by ampulliform conidiogenous cells. Based on phylogenetic placement and morphological variations, we introduce R. pinangae as a new species.
Helminthosphaeriaceae Samuels, Cand. & Magni, Mycologia 89: 144 (1997)
Kramasamuha Subram. & Vittal, Canadian Journal of Botany 51 (6): 1128 (1973)
Subramanian & Vittal (1973) established a monotypic genus Kramasamuha with K. sibiki as the type species. Kramasamuha is only reported as an asexual morph characterized by erect or flexuous, simple or branched and septate conidiophores, monoblastic, conidia are solitary or in clusters, terminal and intercalary conidiogenous cells, septate, and obovoid to pyriform with a short narrow separating cell at the base as a remnant from conidiogenous cell of conidia (Subramanian & Vittal 1973, Hernández-Restrepo et al. 2020). Hernández-Restrepo et al. (2020) provided ITS and LSU molecular data for K. sibiki to place the genus in Helminthosphaeriaceae. We followed Hernández-Restrepo et al. (2020) and updated the phylogenetic analysis (Fig. 73). Two epithets are listed under Kramasamuha (Index Fungorum, 2025 July), but only one species has molecular data. Here, we describe a new species of Kramasamuha, the first report of the genus from a palm host (Supplementary Table 1).
Kramasamuha arengae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 74
Index Fungorum number: IF 904936; Facesoffungi number: FoF 19239
Etymology: Refers to the host genus Arenga, from which the species was collected.
Saprobic on dead petiole of Arenga tremula. Asexual morph: Hyphomycetous. Colonies on natural subÍstrate superficial, effuse, scattered, dark brown. Conidiophores 190–220 × 4–6 μm (x̅ = 210 × 5 μm, n = 10), erect, slightly flexuous, solitary to fasciculate, brown, smooth, multi-septate, simple, becoming paler towards the apex, terminating in an acute apex. Conidiogenous cells 6–10 × 3.5–5.5 μm (x̅ = 7.5 × 4.5 μm, n = 25), monoblastic, pale brown to hyaline, ampulliform, straight to curved, truncate apex, thin-walled, solitary, integrated or discrete, terminal or intercalary. Conidia 30–40 × 10–13 μm (x̅ = 34 × 11.5 μm, n = 25), solitary, smooth, obovoid to pyriform, apex obtuse; when mature, 2-septate, medium cell thick-walled, dark brown, basal and apical cell pale, with short narrow separating cell at base as remnant from conidiogenous cell, sometimes occurring as a papillate or a hyaline acicular appendage on apical cell. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface with entire margin; in reverse yellow in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, on dead petiole of Arenga tremula, 4 Feb 2023, Y.R. Xiong and L. Lu, XG276 (MHZU 23-0188, holotype), ex-type ZHKUCC 24-0183, other ex-type living culture ZHKUCC 24-0184.
GenBank numbers: ZHKUCC 24-0183: ITS – PV578192, LSU – PV578356; ZHKUCC 24-0184: ITS – PV578193, LSU – PV578357.
Notes: Two collections from this study formed a separate lineage and clustered with Kramasamuha sibiki in the phylogenetic tree with 98% ML bootstrap support and 1.00 BYPP (Fig. 73). The nucleotide differences (excluding gaps) between K. arengae (ZHKUCC 24-0183) and K. sibiki (COAD 2632) were checked and given as follows: ITS: 4.00% (21/525 base pairs), and LSU: 0.88% (7/793 base pairs). Morphologically, K. arengae has a papillate or a hyaline acicular appendage on the apical cell of the conidia, which is different from K. sibiki, which only has a short, narrow separating cell at the base of the conidia (Hernández-Restrepo et al. 2020). Although molecular data for K. subramanianii are unavailable, percurrent conidiogenous cells extend up to four times and form secondary branches, a feature not observed in K. arengae (Bispo et al. 2024). Based on phylogenetic placement and morphological variations, we introduce K. arengae as a new species.
Conioscyphales Réblová & Seifert, Persoonia 37: 63 (2016)
Conioscyphaceae Réblová & Seifert, Persoonia 37: 63 (2015)
Conioscypha Höhn., Annls mycol. 2(1): 58 (1904)
Conioscypha verrucosa J. Yang & K.D. Hyde, Fungal Diversity 100: 5–277 (2020). Fig. 76
Index Fungorum number: IF 556630; Facesoffungi number: FoF 06275
Saprobic on dead inflorescence rachis of Livistona chinensis. Asexual morph: Hyphomycetous. Colonies on natural substrate sporodochia, scattered, dark brown or black. Mycelium partly immersed, partly superficial, composed of septate, hyaline hyphae. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 6–15 × 3–8 μm (x̅ = 9.3 × 4.9 μm, n = 10), monoblastic, integrated, terminal, globose or subcylindrical, hyaline, smooth-walled. Conidia 16–20 × 12–16 μm (x̅ = 18.6 × 14.2 μm, n = 25), acrogenous, globose, subglobose, ellipsoidal or obovoid, aseptate, thick-walled, verrucose, guttulate, brown, with a central basal pore. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 8–9 cm diam., at 25 °C, irregular, wrinkled, dense, white mycelium on the surface; in reverse cream.
Known distribution: China (Hyde et al. 2020d, this study).
Material examined: China, Jiangxi Province, Nanchang City, the road next to Meiling National Forest Park, on dead inflorescence rachis of Livistona chinensis, 10 Apr 2024, Y.R. Xiong, XG378 (MHZU 24-0486, new host record), living culture ZHKUCC 25-0035, other living culture ZHKUCC 25-0036.
GenBank numbers: ZHKUCC 25-0035: ITS – PV578152, LSU – PV578322, SSU – PV578492, tef1-α – PV608828, rpb2 – PV595310; ZHKUCC 25-0036: ITS – PV578153, LSU – PV578323, SSU – PV578493, tef1-α – PV608829, rpb2 – PV595311.
Notes: Two collections obtained in this study clustered with Conioscypha verrucosa by 100% ML bootstrap support and 1.00 BYPP (Fig. 75). The nucleotide differences (excluding gaps) between our collection and Co. verrucosa (MFLUCC 18-0419) are 0.59% (3/511 base pairs in ITS) and 1.26% (14/1113 base pairs) in rpb2. Morphological evidence of verrucose and aseptate conidia fits with Co. verrucosa (Hyde et al. 2020d). Conioscypha verrucosa was introduced on decaying wood submerged in a freshwater stream from China by Hyde et al. (2020d). To our knowledge, this is the first report of Conioscypha verrucosa associated with Livistona chinensis.
Pesudoconioscypha Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Index Fungorum number: IF 904937; Facesoffungi number: FoF 19240
Etymology: Refers to it being distinct from Conioscypha on morphology.
Type species: Pseudoconioscypha licualae Y.R. Xiong, Manawas. & K.D. Hyde
Saprobic on dead petiole of Livistona sp. Asexual morph: Colonies on the natural substrate, effuse, widely spreading, superficial, scattered, hairy, brown to dark brown. Mycelium superficial, hyaline hyphae. Conidiophores macronematous, mononematous, unbranched, solitary, erect or slightly flexuous, dark brown, brown towards the apex. Conidiogenous cells polyblastic, verticils, producing conidia from apical conidiogenous loci, forming distinct detachment scar, becoming intercalary, indeterminate, cylindrical. Conidia solitary, straight to slightly curved, oblong to oval, smooth, 3-distoseptate with thick-wall, or aseptate with a concave shape with a hollow central cavity. Sexual morph: Not observed.
Notes: Based on our phylogenetic result (Fig. 75), Pseudoconioscypha formed a distinct clade in Conioscyphaceae, which is sister to Conioscypha with 60% ML bootstrap support and 1.00 BYPP. Morphologically, Pseudoconioscypha forms a distinct detachment scar, which is consistent with the characteristics of Conioscyphaceae by forming cup-like detachment remnant collarettes after unique conidiogenesis (Goh & Hyde 1998, Réblová et al. 2016). However, it differs from Conioscypha by macronematous and mononematous conidiophores, and 3-distoseptate, thick-walled conidia (Goh & Hyde 1998). Here, we describe a new species of Pseudoconioscypha, reported from a palm (Supplementary Table 1).
Pseudoconioscypha licualae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 76
Index Fungorum number: IF 904938; Facesoffungi number: FoF 19241
Etymology: Refers to the host genus Licuala, from which the species was collected.
Saprobic on dead rachis of Licuala sp. Asexual morph: Colonies on the natural substrate, effuse, widely spreading, superficial, scattered, hairy, brown to dark brown. Mycelium superficial, hyaline hyphae. Conidiophores 370–610 × 8–10 μm (x̅ = 509 × 9 μm, n = 10), macronematous, mononematous, unbranched, solitary, erect or slightly flexuous, dark brown, brown towards the apex. Conidiogenous cells 25–35 × 6–8 μm (x̅ = 27.5 × 7.3 μm, n = 25), polyblastic, verticils, producing conidia from apex conidiogenous loci, forming distinct detachment scar, intercalary, indeterminate, cylindrical. Conidia 20–23 × 10–13 μm (x̅ = 21.8 × 10.8 μm, n = 25), solitary, straight to slightly curved, oblong to oval, smooth, 3-distoseptate with thick-wall, or aseptate with a concave shape with a hollow central cavity. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, circular, with dense, white mycelium on the surface with entire margin; in reverse white.
Known distribution: Thailand (this study).
Material examined: Thailand, Narathiwat Province, Toh Daeng Peat Swamp Forest, on dead rachis of Licuala sp., 4 Aug 2023, Y.R. Xiong, XG342 (MFLU 25-0152, holotype), ex-type MFLUCC 25-0214, other ex-type living culture MFLUCC 25-0215.
GenBank numbers: MFLUCC 25-0214: ITS – PV578236, LSU – PV578402, SSU – PV578536, tef1-α – PV608884; MFLUCC 25-0215: ITS – PV578237, LSU – PV578403, SSU – PV578537, tef1-α – PV608885.
Notes: Two collections from this study formed a distinct lineage within Conioscyphaceae in the phylogenetic tree with 60% ML bootstrap support and 1.00 BYPP (Fig. 75). Based on a MegaBLAST (Query cover ≥ 70%) search using the ITS sequence, the closest matches in the NCBI GenBank nucleotide database were Conioscypha pleiomorpha (GenBank LR025178; similarity 497/579 (85.84%), 32 gaps), Vanakripa. chiangmaiense (GenBank OL753684; similarity 497/584 (85.10%), 39 gaps) and C. tenebrosa (GenBank NR171089; similarity 462/560 (82.50%), 58 gaps). The highest similarities using the LSU sequence were Vanakripa minutiellipsoidea (GenBank MN512342; similarity 824/853 (96.60%), 5 gaps), Conioscypha lignicola (GenBank AY484513; similarity 852/885 (96.27%), 4 gaps) and C. tenebrosa (GenBank MK804509; similarity 827/860 (96.16%), 1 gap). The highest similarities using the SSU sequence were C. submersa (GenBank PQ218294; similarity 918/921 (99.67%), 0 gap), C. lignicola (GenBank JQ437439; similarity 978/982 (99.59%), 0 gap) and Vanakripa chiangmaiense (GenBank OP377997; similarity 992/998 (99.40%), 0 gap). The highest similarities using the tef1-α sequence were C. muchuanensis (GenBank PQ278582; similarity 852/915 (93.11%), 0 gap), C. sichuanensis (GenBank OR873430; similarity 875/941 (92.99%), 0 gap) and Dematipyriforma aquilariae (GenBank OP473035; similarity 843/911 (92.54%), 0 gap). Pseudoconioscypha licualae is distinct from Conioscypha and Vanakripa by long macronematous and mononematous conidiophores and 3-distoseptate conidia. Based on phylogenetic placement and morphological variations, we introduce P. licualae as a new species and type of Pseudoconioscypha.
Conlariales K.D. Hyde & Hongsanan, Fungal Diversity 107(14): 94 (2021)
Conlariaceae Huang Zhang, K.D. Hyde & Maharachch., Fungal Diversity 85: 90 (2017)
Conlarium F. Liu & L. Cai, Mycologia 104: 1180 (2012)
Liu et al. (2012) introduced Conlarium with C. duplumascospora as the type species based on morphological evidence and phylogenetic analysis of combined LSU. Conlarium species are mainly known by the asexual morph, which is characterized by muriform, irregularly globose or subglobose conidia (Hyde et al. 2021, 2024c). Subsequently, phylogenetic studies mainly used ITS, LSU and SSU for analysis (Hyde et al. 2024c, Tian et al. 2024a). We used ITS, LSU, and SSU to update phylogenetic analyses of Conlarium (Fig. 78). Currently, 29 epithets are listed under Conlarium (Index Fungorum, 2025 July), and 13 species have molecular data. Among these two species (about 7% of the species in this genus) have been reported from palms, including a new host record described in this study (Supplementary Table 1).
Conlarium thailandense X.D. Yu, H. Zhang & K.D. Hyde, Fungal Divers 95: 1–273 (2019). Fig. 79
Index Fungorum number: IF 555288; Facesoffungi number: FoF 04830
Culture characteristics: Colonies on PDA after 2 weeks reaching 2–3 cm diam., at 25 °C, circular, raised, surface velvety, aerial, sparser, grey; reverse dark brown to black.
Known distribution: Thailand (Phookamsak et al. 2019, this study).
Material examined: Thailand, Narathiwat Province, Toh Daeng Peat Swamp Forest, on dead petiole of Licuala sp., 5 Feb 2023, Y.R. Xiong, XG336 (MFLU 25-0149, new host record), living culture MFLUCC 25-0208, other living culture MFLUCC 25-0209.
GenBank numbers: MFLUCC 25-0208: ITS – PV578154, LSU – PV578324; MFLUCC 25-0209: ITS – PV578155, LSU – PV578325.
Notes: Two collections obtained in this study clustered with Conlarium thailandense by 98% ML bootstrap support and 1.00 BYPP (Fig. 78). The nucleotide differences (excluding gaps) between our collection and C. thailandense (MFLUCC 17-2349) are 1.27% in ITS (6/471 base pairs), and 0.70% in LSU (6/858 base pairs). Morphological evidence of conidiogenous cells and the shape of conidia fit well with C. thailandense (Phookamsak et al. 2019). Conlarium thailandense was introduced on dead wood from Thailand by Phookamsak et al. (2019). Therefore, based on morphology and phylogenetic analysis, we identified our collection as new host records of C. thailandense
Diaporthales Nannf., Nova Acta R. Soc. Scient. Upsal. 8: 53 (1932)
Cytosporaceae Fr. [as ‘Cytisporei’], Syst. orb. veg. (Lundae) 1: 118 (1825)
Cytospora Ehrenb., Sylv. mycol. berol. (Berlin): 2 (1818)
Cytospora phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 81
Index Fungorum number: IF 904939; Facesoffungi number: FoF 19242
Etymology: Refers to the host genus Phoenix, from which the species was collected.
Saprobic on dead petiole of Phoenix canariensis. Asexual morph: Coelomycetous. Conidiomata 750–900 × 260–300 μm (x̅ = 823 × 281 μm, n = 10), stromatic, lamyelloid, scattered, or sometimes in small groups, immersed to partially erumpent, black, flat to discoid, multiple locules with separate walls and multiple ostioles. Conceptacle absent. Locules 60–120 ×60–100 μm (x̅ = 94 × 88 μm, n = 25), numerous, subdivided frequently, independent walls composed of textura epidermoidea cells, irregular shape. Conidiophores 2.5–5 ×1–1.5 μm (x̅ = 3.4 ×1.4 μm, n = 25), borne along the locules, hyaline, branched at the base, embedded in a gelatinous layer, or reduced to conidiogenous cells. Conidiogenous cell 5–8 × 1.5–2 μm (x̅ = 6.7 × 1.7 μm, n = 25), enteroblastic, phialidic, hyaline, smooth. Conidia 3.5–5.5 × 1–2 μm (x̅ = 4.1 × 1.5 μm, n = 25), hyaline, elongate-allantoid, aseptate, thin-walled. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 4–5 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface with entire margin; in reverse yellow in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead petiole of Phoenix canariensis, 4 Feb 2023, Y.R. Xiong and L. Lu, XG300 (MHZU 24-0508, holotype), ex-type ZHKUCC 25-0011, other ex-type living culture ZHKUCC 25-0012.
GenBank numbers: ZHKUCC 25-0011: ITS – PV578158, rpb2 – PV595314, tub2 – PV607962, tef1-α – PV608832; ZHKUCC 25-0012: ITS – PV578159, rpb2 – PV595315, tub2 – PV607963, tef1-α – PV608833.
Notes: Two collections from this study formed a separate lineage and clustered with Cytospora baoshanensis in the phylogenetic tree with 100% ML bootstrap support and 1.00 BYPP (Fig. 81). The nucleotide differences (excluding gaps) between Cy. phoenicis (ZHKUCC 25-0011) and C. baoshanensis (MHZU 24-0530) were checked and given as follows: ITS: 4.85% (26/536 base pairs), rpb2: 11.45% (118/1030 base pairs), tub2: 11.89% (63/530 base pairs), tef1-α: 5.76% (60/1042 base pairs). Cytospora phoenicis has locules with independent walls composed of textura epidermoidea cells, while C. baoshanensis has a peridium comprising brown cells of textura angularis (Lu et al. 2025, Fig. 81). In addition, C. phoenicis conidiophores are branched at the base or reduced to conidiogenous cells and can be distinguished from C. baoshanensis, where conidiophores are irregularly branched at the base and above (Lu et al. 2025, Fig. 81). Based on phylogenetic placement and morphological variations, we introduce C. phoenicis as a new species.
Cytospora pingbianensis Q.J. Shang, K.D. Hyde & J.K. Liu, Mycosphere 11(1): 189–224 (2020). Fig. 82
Index Fungorum number: IF 555514; Facesoffungi number: FoF 05107
Saprobic on dead petiole of Phoenix canariensis. Asexual morph: Coelomycetous. Conidiomata 620–950 × 350–510 μm (x̅ = 793 × 431 μm, n = 10), stromatic, torsellioid, scattered, or sometimes in small groups, erumpent through the surface of bark, black, flat to discoid, multiple locules with separate walls and a single shared ostiole. Conceptacle absent. Ostioles converge to a shared single ostiole. Locules 120–310 × 60–100 μm (x̅ = 200 × 98 μm, n = 25), numerous, subdivided frequently, independent walls composed by textura angularis cells, subglobose or obpyriform shape. Conidiophores 4–6 ×1–2 μm (x̅ = 4.9 ×1.6 μm, n = 25), borne along the locules, hyaline, branched at the base, in the middle or occasionally unbranched, embedded in a gelatinous layer. Conidiogenous cell 7–9.5 × 1.5–2 μm (x̅ = 7.6 × 1.7 μm, n = 25), enteroblastic, phialidic, hyaline, smooth. Conidia 3–4.5 × 1–1.5 μm (x̅ = 3.8 × 1.3 μm, n = 25), hyaline, longate-allantoid, aseptate, thin-walled. Asexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2–3 cm diam., at 25 °C, circular, flat, with entire edge, above brown in the middle and cream in the outer, yellowish in reverse.
Known distribution: China (Shang et al. 2020, this study).
Material examined: China, Yunnan Province, Qujing City, Qujing Normal University, on dead petiole of Phoenix canariensis, 18 Aug 2022, Y.R. Xiong and L. Lu XG107 (MHZU 24-0449, new host record), living culture ZHKUCC 25-0395, other living culture ZHKUCC 25-0396.
GenBank numbers: ZHKUCC 25-0395: ITS – PV578160, tub2 – PV584057, act – PV584051; ZHKUCC 25-0396: ITS – PV578161, tub2 – PV584058, act – PV584052.
Notes: Two collections obtained in this study clustered with C. pingbianensis by 78% ML bootstrap support and 0.98 BYPP (Fig. 80). The nucleotide differences (excluding gaps) between our collection and C. pingbianensis (MFLUCC 18-1204) in act is 1.79% (4/223 base pairs). Morphological evidence of conidiogenous cells and brown conidia fits well with Cytospora (Lin et al. 2024, Fig. 82). Cytospora pingbianensis was introduced as a sexual morph on a dead branch of undetermined wood from China by Shang et al. (2020). Therefore, we identify our collection as the first asexual morph record of C. pingbianensis.
Distoseptisporales Z.L. Luo, K.D. Hyde & Hong Y. Su, Fungal Diversity 99: 482 (2019)
Distoseptisporaceae K.D. Hyde & McKenzie, Fungal Diversity 80: 402 (2016)
Distoseptispora K.D. Hyde, McKenzie & Maharachch., Fungal Diversity 80: 402 (2016)
Distoseptispora was established by Su et al. (2016) to accommodate D. aquatica and D. fluminicola, with the latter as type species based on morphological evidence and phylogenetic analysis based on LSU. Most Distoseptispora species are hyphomycetous, and characterized by macronematous conidiophores, percurrent or cylindrical conidiogenous cells, dematiaceous and euseptate or distoseptate conidia (Su et al. 2016), and the sexual morph is characterized by solitary or gregarious, immersed to semi-immersed, subglobose to ellipsoidal, dark brown ascomata with a short neck, and hyaline, septate ascospores with a mucilaginous sheath (Yang et al. 2021). Subsequently, phylogenetic studies mainly used LSU, ITS, rpb2 and tef1-α in this genus (Yu et al. 2024), which we followed in our study (Fig. 83). Eighty-seven epithets are listed under Distoseptispora (Index Fungorum, 2025 July), and all species have molecular data. Nine species (about 10% of the species in this genus) have been reported from palms, including one new species and three new host records described in this study (Supplementary Table 1).
Distoseptispora elongata Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 84
Index Fungorum number: IF 904940; Facesoffungi number: FoF 19243
Etymology: Refers to the long conidia observed in this species.
Saprobic on dead petiole of Licuala sp. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, effuse, hairy, gregarious, dark brown to black. Mycelium partly immersed, partly superficial on host substrate, composed of septate, branched, pale brown to hyaline hyphae. Conidiophores macronematous, mononematous, septate, erect, cylindrical, unbranched. Conidiogenous cells holoblastic, monoblastic, integrated, determinate, terminal, cylindrical, brown, smooth. Conidia 120–260 × 10–12 μm (x̅ = 202 × 10.6 μm, n = 25), acrogenous, solitary, dry, thin-walled, smooth, obclavate, mostly erect or slight curved, thick-walled,15–27-distoseptate, brown to olivaceous, rounded at apex, with a truncate base, paler towards the apex. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, radially striated with lobate medium with fluffy, dense, white mycelium on the surface, with black crenated margin; in reverse black in the middle and grey at the margin.
Known distribution: Thailand (this study).
Material examined: Thailand, Narathiwat Province, Toh Daeng Peat Swamp Forest, on dead petiole of Licuala sp., 4 Aug 2023, Y.R. Xiong, XG345 (MFLU 25-0154, holotype), ex-type MFLUCC 25-0218, other ex-type living culture MFLUCC 25-0219.
GenBank numbers: MFLUCC 25-0218: ITS – PV578164, LSU – PV578330, rpb2 – PV595316, tef1-α – PV608836; MFLUCC 25-0219: ITS – PV578165, LSU – PV578331, rpb2 – PV595317, tef1-α – PV608837.
Notes: In the phylogenetic analysis of the combined ITS, LSU, tef1-α and rpb2 sequence data, two collections from this study formed a separate lineage and clustered with Distoseptispora palmarum with 100% ML bootstrap support and 1.00 BYPP value (Fig. 83). The nucleotide differences (excluding gaps) between D. elongata (MFLUCC 25-0218) and D. palmarum (MFLUCC 18-1446) were checked and given as follows: ITS: 6.39% (35/547 base pairs), LSU: 0.25% (2/805 base pairs), tef1-α: 3.66% (33/901 base pairs) and rpb2: 4.63% (49/1059 base pairs). Morphologically, D. elongata has holoblastic conidiogenous cells, whereas D. palmarum develops polyblastic conidiogenous cells (Hyde et al. 2019). Moreover, D. elongata has longer conidia (120–260 μm) than D. palmarum (35–180 μm) (Hyde et al. 2019). Based on phylogenetic placement and morphological variations, we introduce D. elongata as a new species.
Distoseptispora nanchangensis Y.F. Hu & Jian Ma, Microbiology Spectrum 11: e02468–02423 (2023). Fig. 85
Index Fungorum number: IF 849134; Facesoffungi number: FoF 17068
Culture characteristics: Colonies on PDA after 2 weeks reaching 8–9 cm diam., at 25 °C, circular, raised, surface velvety, aerial, sparser, dark brown; reverse dark brown to black.
Known distribution: China (Hu et al. 2023, this study).
Material examined: China, Jiangxi Province, Nanchang City, the road next to Meiling National Forest Park, on dead petiole of Livistona chinensis, 11 Apr 2024, Y.R. Xiong, XG431 (MHZU 24-0500, new host record), living culture ZHKUCC 25-0079, other living culture ZHKUCC 25-0080.
GenBank numbers: ZHKUCC 25-0079: ITS – PV578166, LSU – PV578332, rpb2 – PV595318, tef1-α –PV608838; ZHKUCC 25-0080: ITS – PV578167, LSU – PV578333, rpb2 – PV595319, tef1-α –PV608839.
Notes: Two collections obtained in this study clustered with Distoseptispora nanchangensis by 99% ML bootstrap support and 1.00 BYPP values (Fig. 83). The nucleotide differences (excluding gaps) between our collection and D. nanchangensis (HJAUP C1074) in ITS: 0.91% (5/551 base pairs), tef1-α: 0.11% (1/931 base pairs) and rpb2: 0.44% (4/911 base pairs). Morphologically, conidiogenous cells and conidial shapes fit well with Di. nanchangensis (Hu et al. 2023), yet mature conidia in our collection have only 6–13 distosepta, compared to 21–43 reported by Hu et al. (2023). Therefore, based on morphology and phylogenetic analysis, we identified our collection as D. nanchangensis. Distoseptispora nanchangensis was introduced on dead branches of an unidentified broadleaf tree from China (Hu et al. 2023). To our knowledge, this is the first report of D. nanchangensis is associated with Livistona chinensis.
Distoseptispora saprophytica W. Dong, H. Zhang & K.D. Hyde, Mycosphere 12 (1): 38 (2021). Fig. 86
Index Fungorum number: IF 558029; Facesoffungi number: FoF 09550
Saprobic on dead primary rachis of Corypha umbraculifera. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, effuse, hairy, gregarious, brown. Mycelium partly immersed, partly superficial on host substrate, composed of septate, branched, pale brown, thin-walled hyphae. Conidiophores 25–48 × 9–10 μm (x̅ = 36.6 × 9.3 μm, n = 15), macronematous, mononematous, erect, cylindrical, straight or slightly flexuous, or occasionally sharply curving near the base, septate, unbranched, brown, thin-walled, smooth. Conidiogenous cells 9–10.5 × 6–8 μm (x̅ = 9.6 × 6.9 μm, n = 15), polytretic, integrated, terminal and intercalary, determinate, subcylindrical, brown, smooth. Conidia 60–120 × 17–23 μm (x̅ = 93.9 × 19.6 μm, n = 25), acrogenous, solitary, dry, thick-walled, smooth, subcylindrical to obclavate, straight or curved, 3–6-distoseptate, slightly constricted at septa, olivaceous to brown, rounded at apex, with an inconspicuous truncate base and faintly pigmented scar. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 8–9 cm diam., at 25 °C, white-brown from above, black from below, surface rough, dry, with dense mycelium, raised, entire at edge; reverse dark brown to black.
Known distribution: China (this study), Thailand (Dong et al. 2021a).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead primary rachis of Corypha umbraculifera, 5 Feb 2023, Y.R. Xiong and L. Lu, XG146 (MHZU 24-0470, new host record), living culture ZHKUCC 25-0397, other living culture ZHKUCC 25-0398.
GenBank numbers: ZHKUCC 25-0397: ITS – PV578168, LSU – PV578334, rpb2 – PV595320, tef1-α – PV608840; ZHKUCC 25-0398: ITS – PV578169, LSU – PV578335, rpb2 – PV595321, tef1-α – PV608841.
Notes: In the phylogenetic analysis, our collection clustered with Distoseptispora saprophytica by 79% ML bootstrap support and 0.98 BYPP values (Fig. 83). The nucleotide differences (excluding gaps) between our collection and D. saprophytica (MFLUCC 18-1238) are 1.39% (8/572 base pairs) in ITS0.46% (3/656 base pairs) in LSU, 1.26% (12/950 base pairs) in tef1-α and 1.03% (9/876 base pairs) in rpb2. Morphologically, our collection fits well with D. saprophytica (Dong et al. 2021a) with characteristic conidiogenous cells and hyaline conidia. Therefore, based on morphology and phylogenetic analysis, we identified our collection as D. saprophytica. Distoseptispora saprophytica was introduced on submerged wood in a stream from Thailand by Dong et al. (2021a). Here in we introduce our collection as a new host record from Corypha umbraculifera.
Distoseptispora yichunensis Y.F. Hu & Jian Ma, Microbiol. Spectrum 11 (6): e0246823, 13 (2023). Fig. 87
Index Fungorum number: IF 849135
Saprobic on dead leaf sheath of Livistona chinensis. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, brown, and hairy. Mycelium superficial, hyaline hyphae. Conidiophores 25–48 × 9–10 μm (x̅ = 36.6 × 9.3 μm, n = 15), macronematous, mononematous, solitary, straight or flexuous, septate, unbranched, smooth, cylindrical, and brown to dark brown. Conidiogenous cells 9–10.5 × 6–8 μm (x̅ = 9.6 × 6.9 μm, n = 15), monoblastic, integrated, terminal, cylindrical, determinate, pale brown to brown, smooth. Conidia 60–120 × 17–23 μm (x̅ = 93.9 × 19.6 μm, n = 25), acrogenous, solitary, obclavate, straight or curved, pale brown to brown (18–)34–45(–52)-distoseptate, smooth, truncate at the base, rounded at the apex. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 8–9 cm diam., at 25 °C, circular, surface velvety, with brown, denser mycelium at the center, becoming black at the entire margin; reverse dark brown to black.
Known distribution: China (Hu et al. 2023, this study).
Material examined: China, Jiangxi Province, Nanchang City, the road next to Meiling National Forest Park, on dead leaf sheath of Livistona chinensis, 5 Feb 2023, Y.R. Xiong, XG374 (MHZU 24-0484, new host record), living culture ZHKUCC 25-0029, other living culture ZHKUCC 25-0030.
GenBank numbers: ZHKUCC 25-0029: ITS – PV578170, LSU – PV578336, rpb2 – PV595322, tef1-α – PV608842; ZHKUCC 25-0030: ITS – PV578171, LSU – PV578337, rpb2 – PV595323, tef1-α – PV608843.
Notes: Two collections obtained in this study clustered with Distoseptispora yichunensis by 99% ML bootstrap support and 1.00 BYPP (Fig. 83). The nucleotide differences (excluding gaps) betweenour collection and D. yichunensis (HJAUP C1065) in ITS: 0.71% (4/564 base pairs), LSU: 0.35% (2/569 base pairs), tef1-α: 0.11% (1/927 base pairs) and rpb2: 1.03% (2/900 base pairs). Morphological evidence of conidiogenous cells and hyaline conidia fits well with D. yichunensis (Hu et al. 2023). Distoseptispora yichunensis was introduced on dead branches of an unidentified broadleaf tree from China by Hu et al. (2023). Based on morphology and phylogenetic analysis, we identified our collection as new host records of D. yichunensis.
Glomerellales Chadef. ex Réblová, W. Gams & Seifert, Studies in Mycology 68: 170 (2011)
Plectosphaerellaceae W. Gams, Summerbell & Zare, Nova Hedwigia 85 (3-4): 476 (2007)
Acremoniisimulans Tibpromma & K.D. Hyde, Fungal Diversity 93: 88 (2018)
Acremoniisimulans was proposed to accommodate the hyphomycetous species A. thailandensis, which is characterized by pale brown conidiophores and conidia in Plectosphaerellaceae, and LSU, SSU, tef1-α and ITS (Tibpromma et al. 2018). Later, A. cocois and A. hongheensis were introduced to represent the sexual morph of this genus by Konta et al. (2023) and Yang et al. (2023a), respectively. The sexual morph is characterized by oblong to clavate asci, 4–8-spored, unitunicate, with oblong to broadly oblong ascospores, biseriate, hyaline, 1-celled, guttulate (Konta et al. 2023, Yang et al. 2023a). In this study, we used ITS, LSU and SSU to update Acremoniisimulan phylogeny (Fig. 88). There are only three epithets listed for Acremoniisimulans in Index Fungorum (2025 July), and all species are associated with molecular data. Only one species (about 33% of the species in this genus) has been reported from a palm (Supplementary Table 1). In this study, a new geographical record of A. cocois is introduced from Cocos nucifera from China.
Acremoniisimulans cocois Konta & K.D. Hyde, Mycosphere 14 (1): 135 (2023). Fig. 89
Index Fungorum number: IF 559681; Facesoffungi number: FoF 10827
Saprobic on dead segment of Cocos nucifera. Asexual morph: Hyphomycetous. Colonies on natural substrate, effuse and velvety, brown and powdery. Mycelium hyaline, immersed, composed of septate, branched or unbranched hyphae. Conidiophores 20–50 × 3–4 µm (x̅ = 32 × 3.4 µm, n = 20), macronematous, mononematous, scattered, hyaline to pale brown, smooth, thin-walled, septate, branched or unbranched, tapering toward the top, straight or slightly flexuous. Conidiogenous cells 10–12 × 2.5–3 µm (x̅ = 11.2 × 2.7 µm, n = 20), monophialidic, hyaline, cylindrical. Conidia 3–4 × 2.5–3 µm (x̅ = 3.5 × 2.8 µm, n = 30), catenate, pale brown to brown, subglobose to oval, aseptate, rounded at each end, smooth-walled, guttulate. Conidial secession schizolytic. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA reaching 2–3 cm diam., at 25 °C after two weeks, circular, with lobate margin, dense, with an irregularly undulating surface, the central region covered by white, woolly mycelium, gelatinous-folded, while the peripheral mycelium more compact and dark brown to olive. A pale ring along the colony margin, cream. Reverse pale brown to brown, wrinkled.
Known distribution: China (this study), Thailand (Konta et al. 2023).
Material examined: China, Yunnan Province, Xishuangbanna, on a dead segment of Cocos nucifera, 4 February 2024, Y.R. Xiong & Li Lu, XG306 (MHZU 24-0477, new host and new geography record), living culture ZHKUCC 25-0013, other living culture ZHKUCC 25-0014.
GenBank numbers: ZHKUCC 25-0013: ITS – PV578122, LSU – PV578292; ZHKUCC 25-0014: ITS – PV578123, LSU – PV578293.
Acrostalagmus Corda, Icones fungorum hucusque cognitorum 2: 15 (1838)
Acrostalagmus was established by Corda (1838) with the type species A. cinnabarinus. Later, A. cinnabarinus was found to be identical to Verticillium luteoalbum, leading to the proposal of the new combination A. luteoalbus as the type species of Acrostalagmus (Zare et al. 2004). This genus is characterized by mononematous or synnematous conidiophores, enteroblastic, monophialidic conidiogenous cells, and hyaline or bright orange to reddish, oval, ellipsoidal to oblong-ellipsoidal conidia, held together by slime (Zare et al. 2004, Nguyen et al. 2019). Acrostalagmus species are known for their alkali-tolerant (Bondarenko et al. 2016, Bondarenko et al. 2018) or alkalophilic nature (Shi et al. 2023), enabling them to thrive in diverse ecological environments such as forests, sand ridges, marine ecosystems, and polar regions (Youssef et al. 2021, Shi et al. 2023). They are also found in specific substrates, such as saffron soil, needle mushroom, vermicompost, and cacao branches (Artigues & Davet 1984, Rojas et al. 2011, Shi et al. 2023). The genus is notable for its ability to produce a variety of enzymes and bioactive secondary metabolites (Soprunov & Galiulina 1951, Artigues & Davet 1984, Shi et al. 2023), which contribute to its ecological adaptability and potential value in drug development (Shi et al. 2023). These bioactive compounds exhibit a range of activities, making Acrostalagmus a promising candidate for biotechnological and pharmaceutical applications. In this study, ITS, LSU and SSU were employed to update Acrostalagmus phylogeny (Fig. 88). There are 55 epithets of Acrostalagmus in Index Fungorum (2025 July). However, most of these species are synonymised, and only 13 species are accepted in Acrostalagmus (Hyde et al. 2024a), and only two species have molecular data (Crous et al. 2023). Two species (about 4% of the species in this genus) have been reported from palms, including a new host record described in this study
Acrostalagmus luteoalbus (Link) Zare, W. Gams and Schroers, Mycol. Res. 108 (5): 581 (2004) Fig. 90
Index Fungorum number: IF 488126
Saprobic on dead segment of Livistona chinensis. Asexual morph: Hyphomycetous. Colonies on natural substrate, effuse and velvety. Mycelium 1–1.5 µm wide (x̅ = 1.3 µm, n = 20), hyaline, thin and smooth-walled. Conidiophores 3.5–6 µm wide (x̅ = 4.9 µm, n = 20), mononematous, main stipe erect, more or less straight, pale reddish brown or yellowish at the base, almost hyaline at the apex, branched, septate, verruculose, thick-walled. Conidiogenous cells 15–18 × 3–5 µm (x̅ = 17 × 3.8 µm, n = 20), phialides, subhyaline, narrowly flask-shaped, only very slightly swollen at the base, tapering in the middle or upper part into a narrow neck which opens with an inconspicuous collarette. Conidia 4.5–5.5 × 2.5–3.5 µm (x̅ = 4.8 × 2.9 µm, n = 30), forming rounded pale reddish brown slimy heads, oval, aseptate, smooth-walled, guttulate. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after seven days reaching 4–5 cm diam., at 25 °C, filamentous, flat, with filiform edge, flocculent, with loose, cotton-like clusters of mycelia, above dull orange, orange in reverse. Sporulated on PDA after two weeks at 25℃. Conidiophores arise directly from aerial hyphae, septate and branched, pale-orange, 3.5–5 µm wide (x̅ = 4 µm, n = 20), mononematous. Conidiogenous cells phialidic and hyaline. Conidia 4.5–5.5 × 2.5–3.5 µm (x̅ = 4.9 × 2.9 µm, n = 30), oval, pale brown, smooth, aseptate, guttulate.
Known distribution: China (this study), England (Zare et al. 2004), Finland (Andersson et al. 2021), Iran (Mohammadi and Amini 2015), Korea (Nguyen et al. 2019), Russia (Grum-Grzhimaylo et al. 2016), South Africa (Crous et al. 2023).
Material examined: China, Jiangxi Province, Nanchang City, Meiling National Forest Park, on dead segment of Livistona chinensis, 10 April 2024, Y.R. Xiong, XG379 (MHZU 24-0460, new host and new geography record), living culture ZHKUCC 25-0037, other living culture ZHKUCC 25-0038.
Notes: Our collection from palms clustered with A. luteoalbus by 97% ML bootstrap support and 0.96 BYPP values in the multigene phylogenetic analysis (Fig. 88). Based on a MegaBLAST (query cover ≥ 70%) search using the ITS LSU and SSU sequence, the closest matches in the NCBI GenBank nucleotide database were A. luteoalbus (GenBank MH482849; similarity 537/537(100%), 0 gap), A. luteoalbus (GenBank PQ637402; similarity 538/539(99%), 1 gap) and A. luteoalbus (GenBank: OW983372; similarity 538/539(99%), 1 gap) for ITS; A. luteoalbus (GenBank KJ443141; similarity 848/848(100%), 0 gap), A. luteoalbus (GenBank KJ443142; similarity 848/848(100%), 0 gap) and A. luteoalbus (GenBank: KP671745; similarity 848/848(100%), 0 gap) for LSU; A. luteoalbus (GenBank KJ443096; similarity 1078/1091(99%), 3 gaps), A. luteoalbus (GenBank KJ443097; similarity 1078/1091(99%), 3 gaps) and A. luteoalbus (GenBank: KT587308; similarity 1075/1092(98%), 7 gaps) for SSU. Morphologically, conidiogenous cells and hyaline conidia fit well with A. luteoalbus (Zare et al. 2004, Crous et al. 2023, Fig. 90). Based on morphology and phylogenetic analysis, we identified our collection as A. Luteoalbus. Acrostalagmus luteoalbus has been widely recorded from indoor dust, soil and various plant substrates, across freshwater and terrestrial habitats (Zare et al. 2004, Mohammadi & Amini 2015, Grum-Grzhimaylo et al. 2016, Nguyen et al. 2019, Andersson et al. 2021, Crous et al. 2023). To our knowledge, this is the first report of A. luteoalbus from Livistona chinensis and China.
Hypocreales Lindau, Nat. Pflanzenfam., Teil. I (Leipzig) 1(1): 343 (1897)
Calcarisporiaceae Jing Z. Sun, Xing Z. Liu & K.D. Hyde, Mycol. Progr. 16(4): 435 (2017)
Verticimonosporium Matsush., Microfungi of the Solomon Islands and Papua-New Guinea: 68 (1971)
Matsushima (1971) established Verticimonosporium with V. diffractum as the type species. Verticimonosporium is a hyphomycetous genus characterized by conidiophores that are erect, simple, or branched in the lower part, conidiogenous cells that are swollen near the base, with a narrow tip and whorls on the aerial hyphae. Conidia are globose to ellipsoidal, hyaline, and smooth-walled (Matsushima 1971, Gams et al. 1998). Using combined SSU and LSU phylogeny and morphology, Gams et al. (1998) placed Verticimonosporium in Hypocreales. For the updated phylogeny of Verticimonosporium, we used ITS, LSU and SSU sequence data (Fig. 91). Three epithets are listed under Verticimonosporium (Index Fungorum, 2025 July), and two species have molecular data. Three species (75% of the species in this genus) have been reported from palms, including the new species described in this study (Supplementary Table 1).
Verticimonosporium livistonae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 92
Index Fungorum number: IF 904941; Facesoffungi number: FoF 19244
Etymology: Refers to the host genus Livistona, from which the species was collected.
Saprobic on dead petiole of Livistona chinensis. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial. Mycelium superficial, composed of hyaline, smooth, septate, branched aerial hyphae, lanose to almost cobwebby. Conidiophores micronematous, undifferentiated from vegetative hyphae, short. Conidiogenous cells 8–15 × 3–5 μm (widest part) (x̅ = 10 × 4 μm, n = 25), discrete, ampulliform to flask shaped, swollen near the base, with a narrow tip, clustered in regular terminal and intercalary whorls on the aerial hyphae, whorls of 1–4. Conidia 6–8 × 5.5–8 μm (x̅ = 7 × 6.3 μm, n = 25), solitary, subglobose ovoid, with slightly raised truncated remnant at base, hyaline, aseptate, smooth-walled. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, irregular, convex with papillate surface, dense, white mycelium on the surface, radially striated with undulate edge; in reverse yellow.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Nanchang City, the road next to Meiling National Forest Park, on dead petiole of Livistona chinensis, 10 Apr 2024, Y.R. Xiong, XG375 (MHZU 24-0459, holotype), ex-type ZHKUCC 25-0031, other ex-type living culture ZHKUCC 25-0032.
Notes: Our collection from palms formed a separate lineage sister to Verticimonosporium diffractum in the phylogenetic analysis with 99% ML bootstrap support and 1.00 BYPP (Fig. 91). The nucleotide differences (excluding gaps) between Ver. livistonae (ZHKUCC 25-0031) and V. diffractum (CBS 310.72) were checked and given as follows: ITS: 4.12% (24/583 base pairs), LSU: 1.01% (9/897 base pairs), and SSU: 0.41% (4/978 base pairs). Verticimonosporium livistonae produces subglobose to ovoid conidia measuring 6–8 × 5.5–8 μm, which are larger and morphologically distinct from the globose to subglobose conidia of V. diffractum that measures 4.5–6.5 or 5.5–7.5 × 4.5–6 μm (Gams et al. 1998, Fig. 92). Verticimonosporium livistonae also has conidiogenous cells in whorls of 1–4, while in V. diffractum they are in whorls of 1–8 (Gams et al. 1998, Fig. 92). Although V. verticale lacks molecular data, it differs from V. livistonae by short cylindrical to ellipsoidal conidia with both ends obtusely rounded (Wang et al. 2005). Based on phylogenetic placement and morphological variations, we introduce V. livistonae as a new species.
Stachybotryaceae L. Lombard & Crous, Persoonia 32: 283 (2014)
Alfaria Crous, N.J. Montaño-Mata & García-Jim., Persoonia 32: 239 (2014)
Alfaria was introduced by Crous et al. (2014a) to accommodate A. cyperi-esculenti as the type which is a pathogen, causing leaf tip dieback and tuber rot of Cyperus esculentus in Spain (Crous et al. 2014a). The sexual morph is characterized by black, globose, immersed ascomata; fasciculate, subcylindrical asci with obtuse apices, with 2–8 ascospores, hyaline, fusoid-ellipsoid, and 0–3-septate (Crous et al. 2014a, Liang et al. 2019). The asexual morph exhibits microthyrium-like features, including solitary or sporodochial, verticillately or penicillately branched hyaline conidiophores; phialidic conidiogenous cells; and cylindrical to ellipsoidal, hyaline to lightly pigmented, aseptate conidia (Jayawardena et al. 2018, Manawasinghe et al. 2022). We used ITS, LSU, rpb2, and tef1-α to update the phylogeny of Alfaria (Fig. 93). There are 20 epithets accepted in Alfaria (Index Fungorum, 2025 July), and all species are confirmed using molecular data (Manawasinghe et al. 2022, Liu et al. 2024a). Two species (10% of the species in this genus) have been reported from palms, including the A. cyperi-esculenti fresh collection in this study (Supplementary Table 1).
Alfaria cyperi-esculenti Crous, Montaño-Mata & García-Jim., Persoonia 32: 239 (2014). Fig. 94
Index Fungorum number: IF 808924; Facesoffungi number: FoF 03602
Saprobic on dead segment of Caryota mitis. Asexual morph: Coelomycetous. Conidiomata 200–300 μm diam., sporodochial, stromatic, superficial, cupulate to discoid, solitary to gregarious, oval to elongate, composed of cells of textura globulosa or textura angularis. Setae arising from the basal to the fringe of stroma, 100–130 × 4–8 μm (x̅= 113 × 6.6 µm, n = 25), brown, thick-walled, straight, smooth, septate, unbranched, narrowing to sharp apices. Conidiophores up to 47 μm long, arising from the basal stroma, unbranched or branched, hyaline to greenish-brown, smooth-walled. Conidiogenous cells 17–22 × 1–3 μm (x̅= 18.7 × 1.8 µm, n = 25), monoblastic, annellidic, cylindrical to elongate doliiform, hyaline, covered by an olivaceous green mucoid layer, smooth, with conspicuous collarettes and periclinal thickenings. Conidia 6.5–9 × 3.7–5 μm (x̅= 8.2 × 4.3 µm, n = 40), aseptate, smooth-walled, ellipsoidal, greenish-brown to dark brown, guttulate, with germ slit when mature. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 3–4 cm diam., at 25 °C, lobate, slight raised, with filamentous edge, white aerial mycelium and luteous to pale luteous mycelium, fluffy, cotton, above white, yellowish in reverse.
Known distribution: China (this study), Spain (Crous et al. 2014a), Italy (Jayawardena et al. 2018, Manawasinghe et al. 2022).
Material examined: China, Guangxi Province, Guilin City, Guilin Garden botanical garden, on dead segment of Caryota mitis, 3 June 2023, Y.R. Xiong, XG308 (MHZU 24-0509, new host and new geography record), living culture ZHKUCC 25-0015, other living culture ZHKUCC 25-0016.
GenBank numbers: ZHKUCC 25-0015: ITS – PV578126, LSU – PV578296, rpb2 – PV595298, tef1-α – PV608810; ZHKUCC 25-0016: ITS – PV578127, LSU – PV578297, rpb2 – PV595299, tef1-α – PV608811.
Notes: Two collections obtained in this study clustered with A. cyperi-esculenti by 100% ML bootstrap support and 1.00 BYPP value (Fig. 93). The nucleotide differences (excluding gaps) between our collection (ZHKUCC 25-0015) and A. cyperi-esculenti (CPC 23153, ex-type) showed 0% for ITS (0/549 base pairs) and LSU (0/783 base pairs). Morphological evidence of sporodochial conidiomata and ellipsoidal conidia fits well with A. cyperi-esculenti (Jayawardena et al. 2018, Manawasinghe et al. 2022, Fig. 94). Based on morphology and phylogenetic analysis, we identified our collection as a new host and new geographical record of A. cyperi-esculenti.
Memnoniella Höhn., Zentralblatt für Bakteriologie, Parasitenkunde, Infektionskrankheiten und Hygiene, 2. Abt. 60(1/6): 16 (1923)
Memnoniella was established by Höhnel (1923) and typified with M. echinata. Asexually Memnoniella species are characterized by macronematous, mononematous, and unbranched conidiophores, phialidic conidiogenous cells with conspicuous collarettes, producing unicellular, aseptate, smooth to verrucose conidia that are arranged in dry chains or slimy masses (Hyde et al. 2020d, Tennakoon et al. 2021, Du et al. 2025b). Memnoniella was suggested as a synonym of Stachybotrys due to their morphological similarities (Smith 1962, Wang et al. 2015). However, Lombard et al. (2016) reinstated Memnoniella as a distinct genus within Stachybotryaceae, supported by morphology and phylogenetic evidence. Subsequent studies have further validated this classification (Tennakoon et al. 2021, Du et al. 2025b), and in this study ITS, LSU, rpb2 and tub2 were employed to update Memnoniella phylogeny (Fig. 95). There are 31 species accepted in Memnoniella (Index Fungorum, 2025 July), and 24 species have been verified with DNA sequences (Tennakoon et al. 2021, Du et al. 2025b). Four species (about 13% of the species in this genus) have been reported from palms, including a new host record of M. ellipsoidea introduced from Dypsis lutescens from China (Supplementary Table 1).
Memnoniella ellipsoidea L. Lombard & Crous, Persoonia 36: 197 (2016). Fig. 95
Index Fungorum number: IF 816005; Facesoffungi number: FoF 10668
Saprobic on dead segment of Dypsis lutescens. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, effuse, black, glistening, single or clustered, globose aggregated in a large mass. Mycelium is mostly immersed, partly superficial, hyaline. Conidiophores 120–200 × 7–10 µm (x̅ = 167.5 × 8.7 µm, n = 20), macronematous, mononematous, single or in small groups, erect, straight or slightly flexuous, smooth, thick-walled, unbranched, olivaceous brown at the base, becoming subhyaline towards the apex, 2–4-septate, bearing 4–6 conidiogenous cells at its apex. Conidiogenous cells 10–15 × 4–8 (x̅ = 13.9 × 5.7 µm, n = 20), monophialidic, clavate to subcylindrical, discrete, determinate, terminal, smooth, subhyaline to olivaceous brown, smooth-walled. Conidia 10–13 × 6–8 µm (x̅ = 12.1 × 6.9 µm, n = 30), aggregated in black and glistening heads, subglobose to ellipsoidal, acrogenous, aseptate, with 2 globose guttules, verrucose, thick-walled, rounded at both ends, olivaceous brown to dark brown. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4–5 cm diam., at 25 °C, filamentous, flat, with filiform edge, fluffy, white aerial mycelium on surface, above white, yellowish in reverse.
Known distribution: Brazil and Nepal (Lombard et al. 2016), China (Du et al. 2025b, this study).
Material examined: China, Yunnan Province, Xishuangbanna, Dai Nationality Park, on dead segment of Dypsis lutescens, 6 February 2024, Y.R. Xiong, XG241 (MHZU 23-0175, new host record), living culture ZHKUCC 24-0157, other living culture ZHKUCC 24-0158.
GenBank numbers: ZHKUCC 24-0157: ITS – PV578202, LSU – PV578370, rpb2 – PV595334, tub2 – PV584065; ZHKUCC 24-0158: ITS – PV578203, LSU – PV578371, rpb2 – PV595335, tub2 – PV584066.
Myrmecridiales Crous, Persoonia 34: 219 (2015)
Myrmecridiaceae Crous, Persoonia 34: 219 (2015)
Pleurophragmium Costantin, Les mucédinées simples: 100 (1888)
Pleurophragmium pteridophytophilum J.Y. Zhang, K.D. Hyde & Y.Z. Lu, Fungal Diversity 132:349 (2025). Fig. 98
Index Fungorum number: IF 860808; Facesoffungi number: FoF 17054
Saprobic on dead leaf sheath of Trachycarpus fortunei. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, pale brown, velvety, hairy. Mycelium consists of branched hyphae, hyaline, smooth. Conidiophores 160–190 × 5–5.5 μm (x̅ = 171 × 5.4 μm, n = 15), macronematous, mononematous, solitary, erect to flexuous, unbranched, subcylindrical, smooth, dark brown, paler towards apex. Conidiogenous cells 10–20 × 3–4 μm (x̅ = 16.6 × 3.7 μm, n = 25), polyblastic, terminal and intercalary, integrated, subcylindrical, pale brown, hyaline towards apex, with a rachis of pimple-like denticles. Conidia 10–15 × 4–5.5 μm (x̅ = 13 × 4.6 μm, n = 25), solitary, fusiform to obovoid, initially hyaline, but pale brown with age, apex obtuse, 0–4 septate, with a truncate hilum, smooth-walled. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface with entire margin; in reverse cream in the middle and white at the margin.
Known distribution: China (Zhang et al. 2025, this study).
Material examined: China, Jiangxi Province, Pingxiang City, Wugong Mountain National Scenic Area, on dead leaf sheath of Trachycarpus fortunei, 12 Apr 2024, Y.R. Xiong, XG418 (MHZU 24-0466, new host record), living culture ZHKUCC 25-0065, other living culture ZHKUCC 25-0066.
GenBank numbers: ZHKUCC 25-0065: ITS – PV578214, LSU – PV578380, SSU – PV578524, tef1-α – PV608872, rpb2 – PV595340; ZHKUCC 25-0066: ITS – PV578215, LSU – PV578381, SSU – PV578525, tef1-α – PV608873, rpb2 – PV595341.
Notes: In the phylogenetic analysis, our collection clustered with P. pteridophytophilum (KUNCC 23-13858, ex-type) with 100% ML bootstrap support and 1.00 BYPP value (Fig. 97). The nucleotide differences excluding gaps between our collection (ZHKUCC 25-0066) and P. pteridophytophilum (KUNCC 23-13858, ex-type) was: ITS: 3.6% (19/527 base pairs); LSU: 0% (0/795 base pairs). Our collection has polyblastic and intercalary conidiogenous cells, and obovoid conidia, features that fit well with the description of P. pteridophytophilum (Zhang et al. 2025, Fig. 98). Pleurophragmium pteridophytophilum was introduced by Zhang et al. (2025) from dead frond stalks of Pteridaceae sp. in China. Based on morphology and phylogenetic analysis, we identified our collection as a new host record of P. pteridophytophilum from Trachycarpus fortunei.
Pleurophragmium submersum (D.F. Bao, J.C. Kang & Y.Z. Lu) Y.R. Xiong, Manawas. & K.D. Hyde, comb. nov.
Index Fungorum number: IF 904942; Facesoffungi number: FoF 19245
Basionym: Neomyrmecridium submersum D.F. Bao, J.C. Kang &Y.Z. Lu, in Bao et al., Mycosphere 16(1): 3695–3752 (2025)
Holotype: China, Guangxi Province, Gebu Town, on decaying wood submerged in Nanpan River, 24 November 2024, D.F. Bao, NPJ 8–56 (GZAAS 25–0722).
Description: See Bao et al. (2025).
Pleurotheciales Réblová & Seifert, Persoonia 37: 63 (2015)
Pleurotheciaceae Réblová & Seifert, Persoonia 37: 63 (2015)
Phaeoisaria Höhn., Sitzungsber. Kaiserl. Akad. Wiss., Wien. Math.-Naturwiss. Cl., Abt. 1 118 (4): 330 (1909)
Phaeoisaria clematidis (Fuckel) S. Hughes, Can. J. Bot. 36: 794 (1958) Fig. 100
Index Fungorum number: IF 302703; Facesoffungi number: FoF 00452
Saprobic on dead segment of Livistona chinensis. Asexual morph: Hyphomycetous. Colonies synnematal, indeterminate, scattered, erect, rigid, dark brown to black, composed of compactly and parallelly adpressed conidiophores. Mycelium 0.7–1 µm wide (x̅ = 0.9 µm, n = 20), hyaline, branched, aseptate, smooth-walled. Synnemata erect, rigid, dark brown to black, velvety, smooth, composed of compact and parallel adpressed conidiophores, with flared conidiogenous cells in the upper half. Conidiophores 120–330 × 2–3 µm (x̅ = 195 × 2.5 µm, n = 30), macronematous, synnematous, dark brown at the base, paler towards the apex, smooth. Conidiogenous cells 8–16 × 2–3 µm (x̅ = 11.3 × 2.4 µm, n = 30), polyblastic, terminal and intercalary, mostly discrete, sometimes integrated, recurved, smooth, denticulate, subhyaline to pale brown, sympodial, each with one to several denticulate conidiogenous loci. Conidia 4–6 × 2–3 µm (x̅ = 5.4 × 2.3 µm, n = 30), solitary, ellipsoidal to obovoidal, hyaline, aseptate, smooth and thin-walled, guttulate, rounded at the apex, obtuse and tapering towards base. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, circular, raised, with entire edge, dense, brittle and rough at the surface, floccose, above white, olive green in reverse.
Material examined: China, Jiangxi Province, Nanchang City, Meiling National Forest Park, on a dead segment of Livistona chinensis, 10 April 2024, Y.R. Xiong, XG376 (MHZU 24-0485, new host record), living culture ZHKUCC 25-0033, other living culture ZHKUCC 25-0034.
GenBank numbers: ZHKUCC 25-0033: ITS – PV578222, LSU – PV578388, SSU – PV578530, rpb2 – PV595344; ZHKUCC 25-0034: ITS – PV578223, LSU – PV578389, SSU – PV578531, rpb2 – PV595345.
Notes: In the phylogenetic analysis of combined ITS, LSU, SSU and rpb2, our collection clustered with P. clematidis (MFLUCC 17-1341) by 97% ML bootstrap and 0.95 BYPP support (Fig. 99). The nucleotide differences (excluding gaps) between our collection (ZHKUCC 25-0033) and P. clematidis (MFLUCC 17-1341) are 0% in ITS (0/448 base pairs), and LSU (0/817 base pairs), in SSU 0.11% (1/853 base pairs), and in rpb2 0.19% (1/505 base pairs) were observed. Morphologically, conidiogenous cells and hyaline conidia of our collection fit well with P. clematidis (Luo et al. 2018). Based on these, we identified our collection as P. clematidis. Phaeoisaria clematidis commonly occurs on various hosts and is distributed worldwide (de Hoog & Papendorf 1976, Crous et al. 2015, Luo et al. 2018). This species has been reported as a human pathogen that causes a corneal ulcer (Guarro et al. 2000). To our knowledge, this is the first record of Phaeoisaria clematidis on Livistona chinensis.
Pseudodactylariales Crous, Persoonia 39: 421 (2017)
Pseudodactylariaceae Crous, Persoonia 39: 421 (2017)
Pseudodactylaria Crous, Persoonia 39: 421 (2017)
Crous et al. (2017) established Pseudodactylaria with P. xanthorrhoeae as the type species based on morphology and LSU phylogeny in Pseudodactylariaceae. Pseudodactylaria is a hyphomycetous genus characterized by distinct, single, hyaline, unbranched or branched and septate conidiophores, terminal, integrated, polyblastic, denticulate conidiogenous cells and solitary, fusoid-ellipsoid, 1-septate or aseptate, and hyaline conidia (Hyde et al. 2020d, Manawasinghe et al. 2024). Subsequent phylogenetic studies mainly used LSU and ITS (Boonmee et al. 2021, Manawasinghe et al. 2024), and in this study, we used ITS, LSU, SSU, rpb2 and tef1-α to update Pseudodactylaria phylogenetic tree. Thirteen species are listed under Pseudodactylaria (Index Fungorum, 2025 July, Xu et al. 2025), and all have molecular data. Here, we describe a new Pseudodactylaria species, the first report of this genus from a palm (Supplementary Table 1).
Pseudodactylaria caryotae Y.R. Xiong, Manawas., & K.D. Hyde, sp. nov. Fig. 102
Index Fungorum number: IF 904943; Facesoffungi number: FoF 19246
Etymology: Refers to the host genus Caryota, from which the species was collected.
Saprobic on dead inflorescence rachis of Caryota mitis. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, effuse, scattered or aggregated, brown, with glistening conidial masses at the apex. Mycelium partly superficial. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 9–14 × 1.5–2 μm (x̅ = 12.5 × 1.6 μm, n = 10), polyblastic, integrated, sympodial, terminal, denticulate, straight or flexuous, hyaline, cylindrical, smooth. Conidia 15–19 × 4–5 μm (x̅ = 16.8 × 4.4 μm, n = 25), solitary, acropleurogenous, simple, smooth, prominent large guttule in cells or numerous small guttules, 1-septate, narrowly fusiform, subtruncate at the base, sometimes with denticle residue, subobtuse at apex, hyaline, sometimes with a hyaline, irregular appendage. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, sparse, white mycelium on the surface with entire margin; in reverse yellow in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, Xishuangbanna National Forest Park, on dead inflorescence rachis of Caryota mitis, 4 Feb 2023, Y.R. Xiong and L. Lu, XG292 (MHZU 23-0192, holotype), ex-type ZHKUCC 24-0191, other ex-type living culture ZHKUCC 24-0192.
Notes: Two collections from this study clustered in Pseudodactylaria clade and formed a sister lineage to P. brevis in the phylogenetic tree with 98% ML bootstrap and 1.00 BYPP support (Fig. 101). The nucleotide differences (excluding gaps) between P. caryotae (ZHKUCC 24-0191) and its phylogenetically related species were checked and given as follows: P. brevis (MFLUCC 16-0032) - ITS: 4.55% (22/483 base pairs), and LSU: 0.24% (2/827 base pairs); P. jiangxiensis (JAUCC 6196) - ITS: 4.32% (21/486 base pairs), LSU: 0.24% (2/831 base pairs), and rpb2: 7.90% (73/924 base pairs). Pseudodactylaria caryotae has conidiophores reduced to conidiogenous cells, while P. brevis and P. jiangxiensis has conidiophores that are macronematous, mononematous, and sometimes branched (Lin et al. 2018, Xu et al. 2025). In addition, P. caryotae sometimes has conidia with a hyaline, irregular appendage, which is absent in P. brevis and P. jiangxiensis (Lin et al. 2018, Xu et al. 2025). Based on phylogenetic placement and morphological variations, we introduce P. caryotae as a new species.
Rhamphoriales K.D. Hyde & Hongsanan, Fungal Diversity 107: 94 (2021)
Rhamphoriaceae Réblová, Mycologia 11 (4): 754 (2018)
Xylolentia Réblová, Mycologia 11 (4): 759 (2018)
Réblová & Štěpánek (2018) established Xylolentia and typified with X. brunneola based on morphology and combined SSU, LSU, and rpb2 phylogeny. Xylolentia is a holomorphic genus with asexual morphs characterized by macronematous, mononematous and unbranched or branched conidiophores, polyblastic conidiogenous cells with sympodially extending rachis, conidia ellipsoidal to obovoid, hyaline, becoming brown, and aseptate (Réblová & Štěpánek 2018). Sexual morph is characterized by globose and glabrous ascomata with a cylindrical neck, unitunicate and cylindric-clavate asci, long pedicellate and an inamyloid apical ring, ascospores ellipsoidal to obovoid, brown, and septate (Réblová & Štěpánek 2018). Following Réblová & Štěpánek (2018), subsequent phylogenetic studies mainly used ITS, LSU, SSU, rpb2 and tef1-α or without ITS (Yang et al. 2023b, Zhao et al. 2025). In this study, we used ITS, LSU, SSU, rpb2 and tef1-α to update the phylogeny of Xylolentia (Fig. 103). A total of 12 species are listed under Xylolentia (Index Fungorum, 2025 July), and all have molecular data. Among these two species (about 15% of the species in this genus) have been reported from palms, including a new species described in this study (Supplementary Table 1)
Xylolentia licualae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 104
Index Fungorum number: IF 904944; Facesoffungi number: FoF 19247
Etymology: Refers to the host genus Licuala, from which the species was collected.
Saprobic on dead petiole of Licuala sp. Asexual morph: Hyphomycetous. Colonies effuse, hairy, scattered or aggregated, dark brown, with white conidial masses at the apex. Mycelium partly superficial, partly immersed, composed of septate, smooth-walled, brown hyphae. Conidiophores 80–130 × 3–4 μm (x̅ = 110 × 3.7 μm, n = 25), macronematous, mononematous, erect, straight, or slightly flexuous, solitary or aggregated in small groups, cylindrical, smooth-walled, septate, unbranched, dark brown, becoming pale brown to subhyaline at the apex. Conidiogenous cells 15–20 × 3–4 μm (x̅ = 17.7 × 3.5 μm, n = 25), polyblastic, integrated, elongating percurrently, terminal, determinate, cylindrical to cylindric-lageniform, phialidic at the apex, pale brown near the base, subhyaline to hyaline towards the apex, sympodially extending. Conidia 3.5–4.5 × 2–3 μm (x̅ = 4.1 × 2.3 μm, n = 25), aggregated in slimy masses, acropleurogenous, simple, smooth, aseptate, reniform, with a small concavity in the middle, hyaline. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 3 cm diam., at 25 °C, circular, dark, raised, with dark brown or white mycelium on the plicated and waxy-mucoid surface; reverse dark brown with entire margin.
Known distribution: Thailand (this study).
GenBank numbers: MFLUCC 25-0216: ITS – PV578274, LSU – PV578442, SSU – PV578560; MFLUCC 25-0217: ITS – PV578275, LSU – PV578443, SSU – PV578561.
Notes: In the phylogenetic tree, our collection formed a separate lineage, which is sister to Xylolentia bambusae and X. simplex with 98% ML bootstrap and 1.00 BYPP support (Fig. 103). The nucleotide differences (excluding gaps) between X. licualae (MFLUCC 25-0216) and its phylogenetically related species were checked and given as follows; X. bambusae (ZHKUCC 24-1142) - ITS: 5.00% (29/580 base pairs), LSU: 1.24% (11/888 base pairs); and X. simplex (BCRC FU31869) - ITS: 5.56% (35/629 base pairs), LSU: 0.52% (3/575 base pairs). Xylolentia licualae has reniform conidia with a small concavity in the middle (Fig. 104). Our collection differs from X. bambusae by having hyaline, ellipsoidal, subglobose conidia, and is distinct from X. simplex, which has pale brown, ellipsoidal to reniform conidia (Kirschner & Hsieh 2023, Zhao et al. 2025). Based on the phylogenetic placement and morphological variations, we introduce X. licualae as a new species.
Sordariales Chadef. ex D. Hawksw. & O.E. Erikss., Systema Ascomycetum 5: 182 (1986)
Sordariales genera incertae sedis
Rhexodenticula W.A. Baker & Morgan-Jones, Mycotaxon 79: 363 (2001)
Baker et al. (2001) established Rhexodenticula with R. cylindrospora as the type species. Rhexodenticula is a hyphomycetous genus which is characterized by macronematous, mononematous, solitary or caespitose, erect, cylindrical, simple, septate conidiophores, polyblastic, integrated, denticulate conidiogenous cells, and cylindrical, fusiform, obclavate, fusoid-ellipsoid, pale to brown, and septate conidia (Baker et al. 2001, Crous et al. 2016). The sexual morph of Rhexodenticula is characterized by subglobose to ellipsoidal, sub-immersed in the cortical tissue, erupting, papillate ascomata; peridium forming textura angularis cells; asci 8-spored, cylindrical, short pedunculate, unitunicate, truncated apex with apical apparatus and ascospores overlapping, biseriate, fusiform, septate, slightly constricted at septum, hyaline, and with a gelatinous sheath (Fig. 105). Based on LSU phylogeny and morphology Klaubauf et al. (2014) placed Rhexodenticula in Sordariomycetes genera incertae sedis. Subsequently, phylogenetic studies mainly used ITS, LSU, SSU and tef1-α (Dong et al. 2021b). In this study, we used ITS, LSU, SSU, and tef1-α to update phylogenetic analyses of Rhexodenticula (Fig. 105). Five epithets are listed under Rhexodenticula (Index Fungorum, 2025 July), and only three species have molecular data. Here, we describe a new host record of Rhexodenticula acaciae, which is the first report of this genus from a palm host (Supplementary Table 1).
Rhexodenticula acaciae Crous, Persoonia 37: 371 (2016) Fig. 106
Index Fungorum number: IF 819107
Saprobic on dead segment of Livistona chinensis. Asexual morph: Not observed. Sexual morph: Ascomata 150–250 × 120–200 μm (x̅ = 210 × 170 μm, n = 10), subglobose to ellipsoidal, sub-immersed in the cortical tissue, erupting, papillate, dark brown, single or several joined together. Peridium 10–25 µm thick, composed of multi-layers of polygonal cells with large lumina, becoming flat towards the locule, forming textura angularis cells in longitudinal section, pale brown to hyaline. Hamathecium 2.5–3 µm wide, composed of septate pseudoparaphyses in a gelatinous matrix, sparingly branched. Asci 90–140 × 9–13 μm (x̅ = 110 × 10.4 μm, n = 25), 8-spored, cylindrical, short pedunculate, unitunicate, truncated apex with apical apparatus. Ascospores 23–28 × 4–7 μm (x̅ = 25 × 5.6 μm, n = 25), overlapping, biseriate, fusiform, 3-septate, slightly constricted at septum, hyaline, with a gelatinous sheath.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2–3 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface with entire margin; in reverse yellow in the middle and white at the margin.
Known distribution: Australia (Crous et al. 2016), China (this study)
Material examined: China, Jiangxi Province, Pingxiang City, Wugong Mountain National Scenic Area, on dead petiole of Trachycarpus fortunei, 13 Apr 2024, Y.R. Xiong, XG437 (MHZU 24-0469, new host record), living culture ZHKUCC 25-0083, other living culture ZHKUCC 25-0084.
GenBank numbers: ZHKUCC 25-0083: ITS – PV578248, LSU – PV578416, SSU – PV578546; ZHKUCC 25-0084: ITS – PV578249, LSU – PV578417, SSU – PV578547.
Notes: Two collections obtained in this study clustered with Rhexodenticula acaciae by 100% ML bootstrap and 1.00 BYPP support (Fig. 105). The nucleotide differences (excluding gaps) between our collection and R. acaciae (CBS 142119) in ITS is 0.19% (1/521 base pairs). Our isolation is the first sexual report for R. acaciae. Therefore, based on phylogenetic analysis, we identified our collection as a new record of R. acaciae. Rhexodenticula acaciae was introduced on the leaves of Acacia koa from Australia by Crous et al. (2016).
Sporidesmiales Crous, Persoonia 40: 377 (2018)
Sporidesmiaceae Fr., Summa vegetabilium Scandinaviae 2: 504 (1849)
Sporidesmium Link, Mag. Neuesten Entdeck. Gesammten Naturk. Ges. Naturf. Freunde Berlin 3 (1): 41 (1809)
Sporidesmium was established by Link (1809) with S. atrum as the type species. Sporidesmium species are hyphomycetes, characterized by solitary or gregarious conidiophores, monoblastic conidiogenous cells, and pale brown to brown conidia with a hyaline apex and truncate base (Ellis 1971, Su et al. 2016). Only Sp. thailandense and S. lignicola have been reported as sexual morphs, featuring cylindrical asci with a distinct, refractive, wedge-shaped and apical ring, and fusiform ascospores (Zhang et al. 2017, Luo et al. 2019). Shenoy et al. (2006) revealed the phenotypes of Sporidesmium and morphologically similar genera (Ellisembia, Imimyces, Linkosia, Penzigomyces, Polydesmus, Repetophragma, Sporidesmiella and Stanjehughesia), which have multiple evolutionary origins, suggesting Sporidesmium is polyphyletic. Later, many studies confirmed its polyphyletic nature in phylogenetic analyses based on combined ITS, LSU, SSU, rpb2, and tef1-α sequence data, with species distributed across multiple families and orders in Dothideomycetes and Sordariomycetes (Su et al. 2016, Yang et al. 2018b, Liu et al. 2019a). We used ITS, LSU, SSU, and tef1-α to update phylogenetic analyses of Sporidesmium (Fig. 107). Over 500 epithets are listed for this genus (Index Fungorum, 2025 July), and only 32 species have molecular data; many lack it due to historical descriptions (Yang et al. 2018b, Bao et al. 2021). Fifteen species (less than 3% of the species in this genus) have been reported from palms, including a new species described in this study (Supplementary Table 1).
Sporidesmium phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 108
Index Fungorum number: IF 904945; Facesoffungi number: FoF 19248
Etymology: Refers to the host species Phoenix, from which the species was collected.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, irregular, dense, flat, surface smooth, dry, with entire margin, white on the surface; reverse light yellow.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Ganzhou City, on dead segment of Phoenix sylvestris, 9 April 2024, Y.R. Xiong, XG366 (MHZU 24-0481, holotype), ex-type ZHKUCC 25-0023, other ex-type living culture ZHKUCC 25-0024.
GenBank numbers: ZHKUCC 25-0023: ITS – PV578256, LSU – PV578424, SSU – PV578552, tef1-α – PV608894; ZHKUCC 25-0024: ITS – PV578257, LSU – PV578425, SSU – PV578553, tef1-α – PV608895.
Notes: In the phylogenetic analysis, our collection formed a sister lineage to Sporidesmium appendiculatum with 94% ML bootstrap and 1.00 BYPP support (Fig. 107). The nucleotide differences excluding gaps between our collection (ZHKUCC 25-0023, ex-type) and S. appendiculatum (MFLU 18-0981, holotype) were checked and shown - ITS: 4.3% (22/507 base pairs), LSU: 0.7% (6/828 base pairs), and S. appendiculatum lacks SSU and tef1-α sequence data. Morphologically, our collection differs from S. appendiculatum by the subglobose sheath of conidia and lack of appendages, while the conidia of S. appendiculatum has an oblong sheath and hypha-like appendages (Wang et al. 2016). Therefore, our collection introduces a new species, S. phoenicis, based on both phylogeny and morphology evidence.
Vermiculariopsiellales Hern.-Rest., J. Mena, Gené & Crous, Studies in Mycology 86: 91 (2017)
Vermiculariopsiellaceae Hern.-Rest., J. Mena, Gené & Crous, Studies in Mycology 86: 91 (2017)
Vermiculariopsis Torrend, Brotéria Série Botânica 10: 41 (1912)
Vermiculariopsis pediculata (J.L. Cunn.) Hern.-Restr & Crous, Persoonia 49: 130 (2022) Fig. 110
Index Fungorum number: IF 844032
Saprobic on dead segment of Trachycarpus fortunei. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, effuse, velvety, brown, scattered. Mycelium superficial, composed of branched and anastomosing, smooth-walled, septate, subhyaline hyphae bearing conidiogenous cells and setae, becoming thickened and light brown at the point of origin of the setae. Setae 80–120 × 4–5 µm (x̅ = 93 × 4.5 μm, n = 15), erect, dark brown to black, distinctly septate, surface rough and verruculose, upper part 2–4 times branched, half coiled, thin-walled, pale brown near the base, tapering at the tip and subhyaline, branching imperfectly dichotomous, extremities spirally coiled, intertwined. Conidiogenous cells 5–10 × 3.5–5 µm (x̅ = 7 × 3.8 μm, n = 20), phialidic, borne laterally on the superficial hyphae or swollen bases of setae, obclavate to ampullate, some subglobose, subhyaline, smooth-walled. Conidia adhering together to form a whitish pellicle at the base of setae, oblong to cylindrical when young, 6–11 × 2–3 μm (x̅ = 9 × 2.9 μm, n = 25), fusiform when mature, 10–15 × 1.5–2.5 μm (x̅ = 13 × 2 μm, n = 25), straight or slightly curved, hyaline, smooth-walled. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 5 cm diam., at 25 °C, circular, fluffy, flocculent, grey mycelium on the surface with lobate margin; in reverse white in the middle and light brown at the margin.
Known distribution: Australia, Brazil, Cuba, France, French Guiana, Japan (Hernãndez-Restrepo et al. 2022), and China (this study).
GenBank numbers: ZHKUCC 25-0067: ITS – PV578266, LSU – PV578434, rpb2 – PV595370; ZHKUCC 25-0068: ITS – PV578267, LSU – PV578435, rpb2 – PV595371.
Notes: Our collections formed a sister lineage under V. pediculata in the phylogenetic tree with 94% ML bootstrap support and 1.00 BYPP (Fig. 109). The nucleotide differences (excluding gaps) between our isolation and V. pediculata (CBS 579.74, ex-type) were checked and showed 0.8% (4/516 base pairs) in ITS, 0.5% (4/789 base pairs) in LSU, while 2.1% (15/693 base pairs) in rpb2. Our collections fit well with V. pediculata, although they differ from V. pediculata by having roughened setae and shorter conidiogenous cells (5–10 × 3.5–5 µm vs. 10–24 × 3–5 µm) (Hernãndez-Restrepo et al. 2022). These differences may be due to environmental and host factors. Based on phylogenetic placement and morphological variations, we introduce our collections as a new host record of V. pediculata from Trachycarpus fortunei.
Xylariales Nannf., Nova Acta Regiae Societatis Scientiarum Upsaliensis Ser. IV. 8 (2): 66 (1932)
Beltraniaceae Nann., Repertorio sistematico dei miceti dell' uomo e degli animali 4: 498 (1934)
Beltraniella Subram., Proc. Indian Acad. Sci., Sect. B 36 (6): 227 (1952)
Beltraniella was introduced by Subramanian (1952) and typified with e. odinae. Beltraniella is an asexual genus mainly consisting of saprotrophic, litter-inhabiting ascomycetes, which are characterized by the presence of brown, unbranched setae and setiform conidiophores, polyblastic conidiogenous cells, sympodial, and denticulate, producing conidia in an acropleurogenous manner, turbinate or biconic conidia and feature a distinct hyaline transverse band at the equatorial zone (Subramanian 1952, Hyde et al. 2020c). The sexual morph of Beltraniella is proposed as Pseudomassaria or Leiosphaerella like. However, the detailed phylogenetic relationship among Beltraniella Pseudomassaria or Leiosphaerella teleomorphs has not been examined (Kirk et al. 2008, Shirouzu et al. 2010). ITS and LSU sequences are mainly used for phylogenetic analysis for this genus (Shirouzu et al. 2010, Hyde et al. 2020c, d, Liu et al. 2024b) whereas in this study, we employed ITS, LSU and rpb2 to update Beltraniella phylogeny (Fig. 111). Twenty-six species are accepted in Beltraniella (Crous et al. 2016, Crous et al. 2019, Lin et al. 2017b, Tibpromma et al. 2018). However, 33 epithets are accepted in Index Fungorum (2025 July), and only 15 species have molecular data (Hyde 2020d, 2022a, Liu et al. 2024b). Two species (about 6% of the species in this genus) have been reported from palms, including a new record described in this study (Supplementary Table 1).
Beltraniella brevis C.G. Lin, Jian K. Liu & K.D. Hyde, Asian Journal of Mycology 3 (1): 235 (2020) Fig. 112
Index Fungorum number: IF 556729; Facesoffungi number: FoF 06219
Culture characteristics: Colonies on PDA after 2 weeks reaching 9 cm diam., at 25 °C, dense, cream from above, spongy, velutinous, with filiform edge, grey from reverse.
Known distribution: China (Hyde et al. 2020d, this study).
Material examined: China, Jiangxi Province, Nanchang City, Meiling National Forest Park, on dead segment of Trachycarpus fortunei, 11 April 2024, Y.R. Xiong, XG392 (MHZU 24-0488, new host record), living culture ZHKUCC 25-0049, other living culture ZHKUCC 25-0050.
GenBank numbers: ZHKUCC 25-0049: ITS – PV578136, LSU – PV578306; ZHKUCC 25-0050: ITS – PV578137, LSU – PV578307.
Notes: Two collections obtained in this study clustered with Beltraniella brevis by 99% ML bootstrap support and 1.00 BYPP (Fig. 111). The nucleotide differences (excluding gaps) between our isolation (ZHKUCC 25-0049) and B. brevis (GZCC 18-0081, ex-type) in ITS is 0.17% (1/556 base pairs), and LSU is 0.6% (5/766 base pairs). Morphological evidence of brown and erect setae and hyaline conidia with separating cells fits well with Be. brevis (Hyde et al. 2020d). Beltraniella brevis was introduced from China, where it was found on decaying leaves of unknown hosts, by Hyde et al. (2020d). To our knowledge, this is the first report of B. brevis collected from Trachycarpus fortunei from China.
Coniocessiaceae Asgari & Zare, Mycological Progress 10 (2): 195 (2011)
Circinotrichum Nees, Syst. Pilze (Würzburg): 19 (1816)
Nees von Esenbeck (1817) established Circinotrichum with C. maculiforme as the type species. Circinotrichum is a hyphomycetous genus characterized by setae, simple or branched and initially smooth becoming verrucose, conidiogenous cells born laterally on the superficial hyphae and polyblastic, and conidia cylindrical to fusoid and aggregated into a dry whitish layer at the base of the setae (Nees von Esenbeck 1817, Hernández-Restrepo et al. 2022). Hernández-Restrepo et al. (2022) reassessed Circinotrichum based on morphology and combined ITS, LSU, and rpb2 phylogenetic analysis. Subsequently, phylogenetic studies mainly used ITS, LSU, and rpb2 in species identification (Tian et al. 2024a). We used ITS, LSU, rpb2 and tub2 to update the phylogenetic analysis of Circinotrichum (Fig. 113). Currently, 20 species are listed under Circinotrichum (Index Fungorum, 2025 July), and only four species have molecular data. Two species (about10% of the species in this genus) have been reported from palms, including a new species described in this study (Supplementary Table 1).
Circinotrichum phoenicis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 114
Index Fungorum number: IF 904946; Facesoffungi number: FoF 19249
Etymology: Refers to the host genus Phoenix, from which the species was collected.
Saprobic on dead petiole of Phoenix canariensis. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, effuse, velvety, dark brown to black. Mycelium superficial, branched, smooth-walled, aseptate, hyaline. Setae 2–4 μm wide, multi-times sub-dichotomously to irregularly branched, brown, numerous, intertwined, erect, septate, thick-walled, initially root smooth-walled, becoming verrucose; terminal branches paler in colour, verrucose, circinate. Conidiogenous cells 5–7 × 2–4 μm (x̅ = 6.4 × 3 μm, n = 15), borne laterally on the superficial hyphae or swollen bases of setae, short ampulliform, subhyaline, smooth. Conidia 10–13 × 1.5–2.5 μm (x̅ = 11.9 × 2 μm, n = 25), adhering together to form a greyish pellicle at the base of setae, hyaline, smooth, straight or slightly curved, cylindrical to fusiform. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 4 cm diam., at 25 °C, irregular, with fluffy, dense, white mycelium on the surface with undulate margin; in reverse yellow in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, on dead petiole of Phoenix canariensis, 4 Feb 2023, Y.R. Xiong and L. Lu, XG301 (MHZU 23-0195, holotype), ex-type ZHKUCC 24-0197, other ex-type living culture ZHKUCC 24-0198.
GenBank numbers: ZHKUCC 24-0197: ITS – PV578146, LSU – PV578316, rpb2 – PV595308; ZHKUCC 24-0198: ITS – PV578147, LSU – PV578317, rpb2 – PV595309.
Notes: In the phylogenetic analysis of Coniocessiaceae, two collections from this study clustered in Circinotrichum clade and formed a sister lineage to C. australiense with 100% ML bootstrap and 1.00 BYPP support. The nucleotide differences (excluding gaps) between Cir. phoenicis (ZHKUCC 24-0197) and C. australiense (CBS 148706) were checked and given as follows: ITS: 4.67% (24/514 base pairs), LSU: 1.12% (9/802 base pairs), and rpb2: 10.41% (69/663 base pairs). Circinotrichum phoenicis has setae with multiple sub-dichotomously to irregularly branched and intertwined, while C. australiense has setae with L- or T-basal cells giving rise to a network of aggregated conidiogenous cells and irregularly branched (Hernández-Restrepo et al. 2022, Fig. 114). Also, C. phoenicis has short ampulliform conidiogenous cells, while those of C. australiense are subcylindrical to lageniform (Hernández-Restrepo et al. 2022, Fig. 114). Based on the phylogenetic placement and morphological variations, we introduce C. phoenicis as a new species.
Pirozynskiomyces Hern.-Restr. & Crous, Persoonia 49: 111 (2022)
Restrepo et al. (2022) established Pirozynskiomyces accommodate P. brasiliensis (type) and Pir. sinensis based on morphology and phylogenetic analysis of combined ITS, LSU, and rpb2 sequence data in Coniocessiaceae. Pirozynskiomyces is a hyphomycetous genus characterized by simple or branched and verrucose setae, straight, flexuous or coiled, conidiophores reduced to polyblastic and ampulliform to lageniform conidiogenous cells, conidia curved or falcate, obtuse at the base and abruptly attenuate with a cellular appendage at the apex (Hernández-Restrepo et al. 2022). We used ITS, LSU and rpb2 to update Pirozynskiomyces phylogeny (Fig. 113). Three epithets are listed under Pirozynskiomyces (Index Fungorum, 2025 July), and all species have molecular data. We describe a new species of Pirozynskiomyces, which is the first report of this genus from a palm host (Supplementary Table 1).
Pirozynskiomyces trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 115
Index Fungorum number: IF 904947; Facesoffungi number: FoF 19250
Etymology: Refers to the host genus Trachycarpus, from which the species was collected.
Saprobic on dead leaf sheath of Trachycarpus fortunei. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, hairy, white to grey, aggregated. Mycelium immersed, composed of hyaline, smooth, septate, branched hyphae. Setae 110–140 × 4.5–5.5 μm (x̅ = 127 × 4.9 μm, n = 15), erect, unbranched, solitary or in pairs, evenly distributed throughout colony, lower part verruculose, upper part in 1–2 coiled loops, thick-walled, dark brown. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 5–15 × 4–5 μm (x̅ = 9.5 × 4.5 μm, n = 25), ampulliform to lageniform, polyblastic, thin-walled, smooth, solitary or gregarious at the base of setae, pale brown to hyaline. Conidia 15–25 × 2–3 μm (x̅ = 18.9 × 2.4 μm, n = 25), falcate, hyaline, smooth, attenuate with a short cellular appendage at the apex, base with small truncate scar or attenuate. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, irregular, umbonate, with dense, dirty white mycelium on the surface with crateriform and entire margin; in reverse yellow in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Nanchang City, the road next to Meiling National Forest Park, on dead leaf sheath of Trachycarpus fortunei, 5 Feb 2023, Y.R. Xiong, XG432 (MHZU 24-0468, holotype), ex-type ZHKUCC 25-0081, other ex-type living culture ZHKUCC 25-0082.
GenBank numbers: ZHKUCC 25-0081: ITS – PV578226, LSU – PV578392, rpb2 – PV595346; ZHKUCC 25-0082: ITS – PV578227, LSU – PV578393, rpb2 – PV595347.
Notes: Our collection formed a separate lineage, a sister to Pirozynskiomyces sinensis in the phylogenetic tree with 91% ML bootstrap and 1.00 BYPP support (Fig. 113). The nucleotide differences (excluding gaps) between P. trachycarpi (ZHKUCC 25-0081) and P. sinensis (UAMH 11913) in ITS was 2.90% (16/550 base pairs). Pirozynskiomyces trachycarpi has setae in 1–2 coiled loops, while in Pir. sinensis consists of setae that are straight or flexuous (Li et al. 2017). Based on phylogenetic placement and morphological variations, we introduce P. trachycarpi as a new species.
Pseudoconiocessia L. Lu & Tibpromma, Phytotaxa 641 (2): 130 (2024)
Lu et al. (2024) established Pseudoconiocessia with P. xishuangbannaensis as the type species based on morphology and combined ITS, LSU, and rpb2 phylogeny. Pseudoconiocessia was only reported from its sexual morph, which is characterized by carbonaceous and clypeus ascomata, unitunicate, furcate pedicel and apical ring of asci, 4–8-spored, ascospores uniseriate, fusiform or ellipsoid, aseptate with germ slit present when mature (Lu et al. 2024). We used ITS, LSU, and rpb2 to update phylogenetic analyses of Pseudoconiocessia (Fig. 113). Pseudoconiocessia is a monotypic genus (Index Fungorum, 2025 July) with molecular data. We describe a new species, which is the first report of Pseudoconiocessia from a palm host (Supplementary Table 1).
Pseudoconiocessia arengicola Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 116
Index Fungorum number: IF 904948; Facesoffungi number: FoF 19251
Etymology: Refers to the host genus Arenga, from which the species was collected.
Saprobic on dead petiole of Arenga tremula. Asexual morph: Not observed. Sexual morph: Ascomata pseudothecium, immersed, hemispherical to lenticular, immersed under a black clypeus, black, coriaceous, solitary to gregarious, unilocular or multilocular, forming black round spots. Clypeus up to 850 μm, black, considerably exceeding the locular in size. Locule 220–300 × 130–190 μm (x̅ = 264 × 154 μm, n = 10), globose to subglobose, single. Peridium 25–45 μm, comprising several layers, outer layer brown, thick-walled textura angular cells, inner layer light brown to hyaline. Hamathecium 1–2 μm wide paraphyses, numerous, branched, septate, hyaline, embedded in a gelatinous matrix. Asci 50–70 × 4–5 μm (x̅ = 63 × 4.3 μm, n = 25) 8-spored, unitunicate, long-cylindrical to clavate, short-pedicellate or pedicellate, straight or slightly curved, apically rounded, with a wedge-shaped apical ring. Ascospores 6.5–8 × 3–4 μm (x̅ = 7.1 × 3.4 μm, n = 40), uniseriate, brown, aseptate, with conspicuous warts, germ slit on ventral side of the ascospore, straight, nearly the spore-length, lacking mucilaginous sheath.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, irregular, convex, dense, mycelium cream towards the lobate margin; reverse brown.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, unknown forest, on dead petiole of Arenga tremula, 4 Feb 2023, Y.R. Xiong & L. Lu, XG307 (MHZU 25-1055, holotype), ex-type ZHKUCC 25-0089, other ex-type living culture ZHKUCC 25-0090.
Notes: In the phylogenetic analysis of Coniocessiaceae, our collection clustered in Pseudoconiocessia clade and formed a sister lineage to P. xishuangbannaensis with 100% ML bootstrap support and 1.00 BYPP (Fig. 113). The nucleotide differences (excluding gaps) between P. arengicola and P. xishuangbannaensis revealed 1.67% (9/538 base pairs) in ITS and 13.35% (112/839 base pairs) in LSU. Pseudoconiocessia arengicola differs from P. xishuangbannaensis by its clypeus considerably exceeding the locular in size (Lu et al. 2024). Based on phylogenetic placement and morphological variations, we introduce P. arengicola as a new species.
Fasciatisporaceae S.N. Zhang, K.D. Hyde & J.K. Liu, Fungal Diversity 100: 227 (2020)
Fasciatispora K.D. Hyde, Transactions of the Mycological Society of Japan 32: 265 (1991)
Hyde et al. (1991) established Fasciatispora with F. nypae as type species. The sexual morph of Fasciatispora is characterized by lying beneath a clypeus of ascomata, a wedge-shaped subapical ring of asci, and pale brown to brown, ellipsoidal, ovoid or rhomboid, aseptate ascospores with a central pallid band (Hyde et al. 2020b). The asexual morph characterized by colonies on the substratum superficial, conidiophores arising from the stromata, macronematous and unbranched, conidiogenous cells holoblastic and integrated, conidia brown or reddish-brown and with or without an inconspicuous hyaline longitudinal slit (Zhang et al. 2024). Based on morphological evidence and combined ITS, LSU, rpb2, tub2, SSU and tef1-α phylogeny, Hyde et al. (2020b) placed Fasciatispora in Fasciatisporaceae. Subsequently, phylogenetic studies mainly used LSU, SSU, rpb2, and tef1-α or tub2 data for species delineation (Dissanayake et al. 2024a, Zhang et al. 2024), and this study used ITS, LSU, rpb2, tub2, SSU, and tef1-α to update the phylogeny of Fasciatispora (Fig. 117). Currently, 13 epithets are listed under Fasciatispora (Index Fungorum, 2025 July), and only seven species have molecular data. Among these 12 species (80% of the species in this genus) have been reported from palms, including one new species and one new host recorded and described in this study (Supplementary Table 1).
Fasciatispora elaeidis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 118
Index Fungorum number: IF 904949; Facesoffungi number: FoF 19252
Etymology: Refers to the host genus Elaeis, from which the species was collected.
Saprobic on dead petiole of Elaeis guineensis. Asexual morph: Not observed. Sexual morph: Ascomata 100–180 × 90–150 μm (x̅ = 134 × 111 μm, n = 10), clustered ascomata with individual ostioles, immersed, visible as black, circular convex, sometimes solitary, mostly aggregated into small groups, globose, beneath coalescent clypei. Peridium 10–20 μm wide, 3–5-layered, comprising brown, thick-walled cells of textura angularis and textura globulosa. Hamathecium 3–5 μm wide, septate, branched, hyaline, numerous paraphysoids. Asci 70–100 × 10–15 μm (x̅ = 82 × 12.5 μm, n = 25), 8-spored, unitunicate, cylindrical, short pedicellate, inconspicuous wedge-shaped apical ring, apex rounded. Ascospores 14–17 × 7–9 μm (x̅ = 15.8 × 7.9 μm, n = 25), uniseriate, or biseriate at middle of asci, ellipsoidal to obovoid, aseptate, hyaline when immature, brown when mature, umbilicated at medium or upper part, verruculose, surround by a mucilaginous sheath.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, dense mycelium on the surface, medium yellowish, white margin; in reverse yellow in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead petiole of Elaeis guineensis, 5 Feb 2023, Y.R. Xiong and L. Lu, XG178 (MHZU 24-0452, holotype), ex-type ZHKUCC 25-0003, other ex-type living culture ZHKUCC 25-0004.
GenBank numbers: ZHKUCC 25-0003: ITS – PV578174, LSU – PV578338, SSU – PV578496, tef1-α – PV608844, rpb2 – PV595324, tub2 – PV584061; ZHKUCC 25-0004: ITS – PV578175, LSU – PV578339, SSU – PV578497, tef1-α – PV608845, rpb2 – PV595325, tub2 – PV584062.
Notes: Our collection formed a distinct lineage within Fasciatispora in the phylogenetic tree with 100% ML bootstrap and 1.00 BYPP support (Fig. 117). Based on a MegaBLAST (Query cover ≥ 70%) search using the ITS sequence, the closest matches in the NCBI GenBank nucleotide database were Xylaria sp. (GenBank JX156382; similarity 348/373 (93.30%), 4 gaps), Vamsapriya sp. (GenBank PQ568141; similarity 342/370 (92.43%), 6 gaps) and Vamsapriya uniseptata (GenBank PP407904; similarity 334/363 (92.01%), 8 gaps). The highest similarities using the LSU sequence were F. nypae (GenBank KP744484; similarity 825/844 (97.75%), 4 gaps), F. cocoes (GenBank PP593428; similarity 827/848 (97.52%), 5 gaps) and F. calami (GenBank NG066198; similarity 826/847 (97.52%), 5 gaps). The highest similarities using the SSU sequence were Induratia apiospora (GenBank NG242948; similarity 1013/1025 (98.83%), 0 gap), Astrocystis sp. (GenBank OM836751; similarity 1013/1026 (98.73%), 1 gap) and Geniculisynnema termiticola (GenBank AB274812; similarity 1013/1026 (98.73%), 2 gaps). The highest similarities using the tef1-α sequence were Vamsapriya sp. (GenBank MW759506; similarity 812/937 (86.66%), 10 gap), Metacordyceps liangshanensis (GenBank EF468756; similarity 817/943 (86.64%), 7 gaps) and Cordycipitaceae sp. (GenBank OR115233; similarity 820/948 (86.50%), 8 gaps). The highest similarities using the tub2 sequence were Fusarium lactis (GenBank FR870322; similarity 230/268 (85.82%), 9 gap), Clonostachys solani (GenBank OQ982853; similarity 241/281 (85.77%), 18 gaps) and C. aureofulvella (GenBank OQ982576; similarity 241/281 (85.77%), 18 gaps). The highest similarities using the rpb2 sequence were Biscogniauxia citriformis (GenBank JX507780; similarity 794/1004 (79.08%), 20 gap), B. cylindrispora (GenBank JX507782; similarity 788/998 (78.96%), 10 gap) and B. marginata (GenBank KU684310; similarity 786/996 (78.92%), 14 gaps). Morphologically, F. elaeidis differs from other species of Fasciatispora by having multilocular ascomata and verruculose ascospores. Based on phylogenetic placement and morphological variations, we introduce F. elaeidis as a new species.
Fasciatispora sichuanensis L.S. Dissan., K.D. Hyde & J.C. Kang, Mycosphere 15(1), 1675–1793 (2024) Fig. 119
Index Fungorum number: IF 850220; Facesoffungi number: FoF 14914
Saprobic on dead leaf sheath of Arenga obtusifolia. Asexual morph: Not observed. Sexual morph: Ascomata 200–290 × 130–180 μm (x̅ = 242 × 160 μm, n = 10), pseudothecium, semi-immersed, visible as black, circular dots, mostly solitary, sometimes aggregated into small groups, globose, beneath a clypeus, with ostioles. Peridium 20–30 μm wide, multi-layered, outer layer comprising brown, thick-walled cells of textura angularis. Hamathecium 2–3 μm wide, septate, branched, hyaline, numerous filamentous paraphysoids. Asci 70–110 × 8–11 μm (x̅ = 89 × 9.5 μm, n = 25), 8-spored, unitunicate, cylindrical, short pedicellate, inconspicuous apical ring, apex rounded. Ascospores 13–16 × 6–8 μm (x̅ = 14.4 × 6.8 μm, n = 25), uniseriate, ellipsoidal to obovoid, aseptate, hyaline when immature, brown when mature, with wide umbilicated equatorial pallid band, smooth, guttulate (1–2 large guttules at the center), without a mucilaginous sheath and lacking a germ slit.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, white mycelium on the surface, sparse at the edge, dense in the middle and outwardly strongly radiating; in reverse cream.
Known distribution: China (Dissanayake et al. 2024a, Xiong et al. 2025, this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead leaf sheath of Arenga obtusifolia, 5 Feb 2023, Y.R. Xiong and L. Lu, XG161 (MHZU 23-0142, new host record), living culture ZHKUCC 24-0091, other living culture ZHKUCC 24-0092.
GenBank numbers: ZHKUCC 24-0091: ITS – PV578176, LSU – PV578340, SSU – PV578498, tef1-α – PV608846, rpb2 – PV595326, tub2 – PV584063; ZHKUCC 24-0092: ITS – PV578177, LSU – PV578341, SSU – PV578499, tef1-α – PV608847, rpb2 – PV595327, tub2 – PV584064.
Notes: In the phylogenetic analysis of Fasciatisporaceae, our collection clustered with Fasciatispora sichuanensis by 96% ML bootstrap support and 1.00 BYPP (Fig. 117). The nucleotide differences (excluding gaps) between our collection and F. sichuanensis (KUNCC 23-15541) in ITS is 0.42% (2/478 base pairs). Morphological evidence of unitunicate, cylindrical asci and ascospores with a wide pallid equatorial band fits well with F. sichuanensis (Dissanayake et al. 2024a). Therefore, based on morphology and phylogenetic analysis, we identified our collection as F. sichuanensis. Fasciatispora sichuanensis was introduced as a dead twig of Poaceae sp. from China by Dissanayake et al. (2024a). Xiong et al. (2025) reported a new record on a dead petiole of Wodyetia bifurcate from China. To our knowledge, this is the first report of F. sichuanensis from Arenga obtusifolia.
Cannoniaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Index Fungorum number: IF 904950; Facesoffungi number: FoF 19253
Etymology: Refers to the name of the type genus.
Type genus: Cannonia Joanne E. Taylor & K.D. Hyde
Saprobic on dead substrates. Asexual morph: Not observed. Sexual morph: Ascomata perithecium, solitary, columnar, venter immersed, long neck. Venter globose to subglobose, unilocular. Ostioles cylindrical, periphysate, comprising textura porrecta cells. Peridium multilayers, comprising textura angularis cells with pit connections. Hamathecium paraphyses, periphysoids, unbranched, septate, hyaline, embedded in a gelatinous matrix. Asci 8-spored, unitunicate, cylindric-clavate, short stalked, apical ring indistinct or absent. Ascospores overlapping biseriate, aseptate, cymbiform, ovoid to ellipsoidal, hyaline to brown, with an obvious collapsed germ slit with a unilateral depression, smooth-walled.
Notes: Cannoniaceae is introduced to accommodate the genus Cannonia, which formed a sister branch with Spirodecosporaceae within Xylariales (Fig. 120). Cannoniaceae is typical of the Xylariales family in having ascospores with a germ-slit (Samarakoon et al. 2022). However, Cannoniaceae is characterised by ascomata with long necks, which differ from those of Spirodecosporaceae, which have cylindrical, periphysate ascomata (Sugita et al. 2022). Moreover, Cannoniaceae is distinctive within Xylariales by a peridium composed of textura angularis cells with pit connections. Based on phylogenetic placement and morphological variation, we proposed that Cannoniaceae be recognized as a new family in Xylariales.
Cannonia Joanne E. Taylor & K.D. Hyde, Mycol. Res. 103 (11): 1398 (1999)
Taylor & Hyde (1999) established Cannonia with C. australis as the type species. Cannonia only reported sexual morph, which is characterized by long ostiolate ascomata and aseptate ascospores with a germ slit (Taylor & Hyde 1999, this study). This genus was originally placed in the Xylariaceae based on the morphological characteristics of the basis of ascomata being immersed beneath a clypeus and surrounded by some stromatic tissues (Taylor & Hyde 1999). Although Trierveiler-Pereira et al. (2012) reported Can. australis, without corresponding molecular data. Wendt et al. (2017) transferred Cannonia to the Xylariales genera incertae sedis. Subsequently, Daranagama et al. (2018) suggest placing this genus in Coniochaetales pending fresh collections, as it is atypical of Xylariales. Our study provides molecular data for Cannonia for the first time and describes a new species. Based on phylogenetic analysis of combined ITS, LSU, tef1-α, tub2, and rpb2, we determined the position of Cannonia within Xylariales. Based on phylogenetic results and morphological variation, we supported the proposal of a new family to accommodate Cannonia. Two species have been reported from palms, including the new species described in this study (Supplementary Table 1).
Cannonia trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 121
Index Fungorum number: IF 904951; Facesoffungi number: FoF 19254
Etymology: Refers to the host genus Trachycarpus, from which the species was collected.
Saprobic on dead leaf sheath of Trachycarpus fortunei. Asexual morph: Not observed. Sexual morph: Ascomata perithecial, solitary, scattered to gregarious, columnar, venter, with a dark, erumpent, central neck. Venter 200–260 × 250–350 μm (x̅ = 232 × 292 μm, n = 10), globose to subglobose, unilocular, brown to dark brown. Ostioles 680–770 × 45–55 μm (x̅ = 733 × 52 μm, n = 10), apex widest part 80–100 μm, cylindrical, dark brown, periphysate, composing textura porrecta cells, ascospores forming a sticky mass at the tip of the perithecial neck. Peridium 40–80 μm, multilayers, brown, composing textura angularis cells with pit connections. Hamathecium 2–3 μm wide paraphyses, periphysoids, numerous, unbranched, septate, hyaline, embedded in a gelatinous matrix. Asci 45–60 × 10–13 μm (x̅ = 50 × 12 μm, n = 25) 8-spored, unitunicate, cylindric-clavate, short stalked, curved, apically rounded, apical ring indistinct or absent. Ascospores 9–12 × 4–8 μm (x̅ = 11 × 5.6 μm, n = 40), overlapping biseriate, aseptate, hyaline with guttules when immature, cymbiform, ovoid to ellipsoidal, becoming brown when mature, with rounded end, with an obvious collapsed germ slit with a unilateral depression, smooth-walled.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, circular, margin entire, dense, surface filamentous, cream at the margin, olivaceous in the center; reverse cream at the margin, dark olivaceous in the center.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Kunming City, the way near Kunming Institute of Botany, on dead leaf sheath of Trachycarpus fortunei, 7 May 2021, Y.R. Xiong & L. Lu, XG023 (MHZU 24-0443, holotype).
GenBank numbers: MHZU 24-0443a: ITS – PV578194, LSU – PV578360, rpb2 – PV595332, tub2 – PV607964; MHZU 24-0443b: ITS – PV578195, LSU – PV578361, rpb2 – PV595333, tub2 – PV607965.
Notes: Two collections formed a separate lineage in the phylogenetic tree with 100% ML bootstrap support and 1.00 BYPP (Fig. 120). Based on a MegaBLAST (Query cover ≥ 70%) search using the LSU sequence, the closest matches in the NCBI GenBank nucleotide database were Lopadostoma meridionale (GenBank KC774595; similarity 864/900 (96.00%), 11 gaps), Spirodecospora sp. (GenBank PQ885427; similarity 886/925 (95.78%), 9 gaps) and Barrmaelia rhamnicola (GenBank MF488990; similarity 883/937 (94.24%), 11 gaps). The highest similarities using the ITS sequence were Daldinia korfii (GenBank NR_152500; similarity 495/574 (86.24%), 25 gaps), D. childiae (GenBank MN341622; similarity 497/578 (85.99%), 28 gaps) and D. bambusicola (GenBank OQ831975; similarity 489/571 (85.64%), 24 gaps). The highest similarities using the rpb2 sequence were Lopadostoma linospermum (GenBank KC774544; similarity 729/909 (80.20%), 20 gap) and Lopadostoma lechatii (GenBank KC774543; similarity 735/926 (79.37%), 23 gaps), Eutypa cerasi (GenBank MW814894; similarity 726/923 (78.66%), 25 gaps). The highest similarities using the tub2 sequence were Sporidesmium gyrinomorphum (GenBank KX090080; similarity 835/923 (90.47%), 16 gaps) and Stilbochaeta novae-guineensis (GenBank AY951711; similarity 830/921 (90.12%), 10 gaps), Codinaea assamica (GenBank MF489024; similarity 829/921 (90.01%), 11 gaps). This is the first molecular data for Cannonia. Our collection matches C. australis by developing a long ostiole and an aseptate ascospore (Taylor & Hyde 1999). However, C. trachycarpi has aperiphysate ascomata, and pit connections in the peridium and lacks a clypeus, whereas C. australis has periphysate ascomata, and possess a clypeus but has no pit connections (Taylor & Hyde 1999). We propose that our collection represents a novel species distinct from C. australis, based on morphological evidence. In addition, this study provides the first molecular data for the genus Cannonia.
Vamsapriyaceae Y.R. Sun, Yong Wang bis & K.D. Hyde, in Sun, et al., Journal of Fungi 7(891), 7 (2021)
Vamsapriya Gawas & Bhat, Mycotaxon 94: 150 (2006)
Vamsapriya rhapidicola Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 123
Index Fungorum number: IF 904952; Facesoffungi number: FoF 19255
Etymology: Refers to the host genus Rhapis, from which the species was collected.
Saprobic on dead petiole of Rhapis excelsa. Asexual morph: Hyphomycetous. Colonies on the substrate superficial, effuse, dark brown, hairy, scattered. Synnemata 800–1100 × 20–30 μm (x̅ = 936 × 24.6 μm, n = 10), erect, rigid, dark brown, composed of compact parallel conidiophores. Conidiophores macronematous, synnematous, erect, cylindrical, straight or slightly flexuous, dark brown, smooth-walled. Conidiogenous cells 9–15 × 4.5–6 μm (x̅ = 11.1 × 5.4 μm, n = 25), monotretic, integrated, terminal, brown, cylindrical to clavate, apically rounded with scar-bearing umbilicate abscission scar, verrucose. Conidia not observed in the examined specimens. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface with entire margin; in reverse white.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead petiole of Rhapis excelsa, 5 Feb 2023, Y.R. Xiong and L. Lu, XG222 (MHZU 23-0171, holotype), ex-type ZHKUCC 24-0149, other ex-type living culture ZHKUCC 24-0150.
GenBank numbers: ZHKUCC 24-0149: ITS – PV578262, LSU – PV578430, tef1-α – PV608900, rpb2 – PV595366, tub2 – PV584069; ZHKUCC 24-0150: ITS – PV578263, LSU – PV578431, tef1-α – PV608901, rpb2 – PV595367, tub2 – PV584070.
Notes: In the multigene phylogenetic tree of Vamsapriya our collections formed a separate clade with 75% ML bootstrap support (Fig. 122). Based on a MegaBLAST (Query cover ≥ 70%) search using the ITS sequence, the closest matches in NCBIs GenBank nucleotide database were V. uniseptata (GenBank PP407904; similarity 441/468 (94.23%), 6 gaps), V. yunnana (GenBank MG833874; similarity 480/510 (94.12%), 8 gaps) and V. bambusicola (GenBank KM462835; similarity 532/568 (93.66%), 7 gaps). The highest similarities using the LSU sequence were V. indica (GenBank MZ420762; similarity 820/822 (99.76%), 0 gap), V. uniseptata (GenBank PP407717; similarity 804/807 (99.63%), 0 gap) and V. khunkonensis (GenBank NG_066165; similarity 786/791 (99.37%), 0 gap). The highest similarities using the rpb2 sequence were Va. indica (GenBank OK560921; similarity 692/758 (91.29%), 0 gap), V. khunkonensis (GenBank KM462829; similarity 731/807 (90.58%), 0 gap) and V. bambusicola (GenBank KM462834; similarity 731/808 (90.47%), 0 gap). The highest similarities using the tef1-α sequence were V. bambusicola (GenBank KU940209; similarity 889/961 (92.51%), 3 gaps), V. indica (GenBank MZ442694; similarity 854/924 (92.42%), 1 gap) and V. khunkonensis (GenBank KU940211; similarity 888/961 (92.40%), 3 gaps). The highest similarities using the tub2 sequence were Daldinia theissenii (GenBank KU684130; similarity 735/796 (92.34%), 0 gap), Daldinia clavata (GenBank AY951693; similarity 734/796 (92.21%), 0 gap) and Colletotrichum johnstonii (GenBank MT456875; similarity 837/925 (90.49%), 6 gaps). Although we did not observe conidia in the examined specimens, we did observe a clear conidial abscission scar. We obtained a pure culture from germinating conidiogenous cells. Based on verrucose conidiogenous cells and differences in molecular evidence, we introduce V. rhapidicola as a new species.
Vamsapriya trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 124
Index Fungorum number: IF 904953; Facesoffungi number: FoF 19256
Etymology: Refers to the host genus Trachycarpus, from which the species was collected.
Saprobic on dead leaf sheath of Trachycarpus fortunei. Asexual morph: Hyphomycetous. Colonies on the substrate superficial, effuse, dark brown, hairy, scattered. Synnemata 700–860 × 30–40 μm (x̅ = 790 × 32 μm, n = 10), erect, rigid, dark brown, composed of compact parallel conidiophores. Conidiophores macronematous, synnematous, erect, cylindrical, straight or slightly flexuous, dark brown, smooth-walled. Conidiogenous cells 10–17 × 4–5 μm (x̅ = 13.6 × 4.7 μm, n = 25), monotretic, integrated, terminal, brown, cylindrical to clavate, apically rounded with scar-bearing umbilicate abscission scar, verrucose. Conidia not observed in the examined specimens. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface with entire margin; in reverse white.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, on dead leaf sheath of Trachycarpus fortunei, 5 Feb 2023, Y.R. Xiong and L. Lu, XG267 (MHZU 23-0186, holotype), ex-type ZHKUCC 24-0179, other ex-type living culture ZHKUCC 24-0180.
GenBank numbers: ZHKUCC 24-0179: ITS – PV578264, LSU – PV578432, tef1-α – PV608902, rpb2 – PV595368; ZHKUCC 24-0180: ITS – PV578265, LSU – PV578433, tef1-α – PV608903, rpb2 – PV595369.
Xylariaceae Tul. & C. Tul., Selecta Fungorum Carpologia, Tomus Secundus. Xylariei - Valsei - Sphaeriei 2: 3 (1863)
Virgaria Nees, System der Pilze und Schwämme: 54 (1817)
Virgaria was proposed by Nees von Esenbeck (1816) and classified within the family Xylariaceae, typified by a hyphomycete species Vi. nigra (Seifert et al. 2011). The asexual morph of Virgaria is characterized by macronematous, mononematous, and branched conidiophores, with polyblastic, sympodial conidiogenous cells and reniform to ellipsoidal, aseptate conidia (Liu et al. 2024a). Virgaria has been synonymous with Ascovirgaria, though Virgaria is the recommended name (Zhang et al. 2024). We used ITS and LSU to update phylogenetic studies for Virgaria (Fig. 125). There are 11 species accepted in Virgaria (Index Fungorum, 2025 July), and only three species have molecular data (Liu et al. 2024a, Zhang et al. 2024). Three species (about 27% of the species in this genus) have been reported from palms (Supplementary Table 1), including a new host and a new geographical record in this study.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2–3 cm diam., at 25 °C, circular, flat, with entire edge, above brown in the middle and cream in the outer, yellowish in reverse.
Known distribution: Cuba, Canada, France, Italy, Spain, United States of America (Matsushima 1975, Hughes 1978, Seifert et al. 2011, Nonaka et al. 2013), Thailand (Liu et al. 2024a, Zhang et al. 2024), China (this study).
Virgaria nigra (Link) Nees, System der Pilze und Schwämme: 54 (1817) Fig. 126
Index Fungorum number: IF 213598; Facesoffungi number: FoF 03079
Saprobic on dead segment of Trachycarpus fortunei. Asexual morph: Hyphomycetous. Colonies on natural substrate, effuse, brown to black, dense, velvety. Mycelium 2–3 µm wide (x̅ = 2.3 µm, n = 20), immersed, composed of hyaline to brown, branched, septate, smooth-walled hyphae. Conidiophores 1–3 µm wide (x̅ = 2 µm, n = 20), macronematous, mononematous, fasciculate to procumbent, straight or flexuous, brown at the base, paler towards the apex, branched, septate, verruculose, thick-walled. Conidiogenous cells 1.5–3.5 µm wide (x̅ = 2.9 µm, n = 20), polyblastic, integrated, terminal, subcylindrical, tapered to a pointed tip, subhyaline to pale brown, denticulate. Conidia 4–5 × 2.5–3 µm (x̅ = 4.4 × 2.8 µm, n = 30), solitary, subglobose to ellipsoidal, some ovoid, brown, aseptate, smooth-walled, guttulate. Sexual morph: Not observed.
Material examined: China, Jiangxi Province, Nanchang City, Meiling National Forest Park, on dead segment of Trachycarpus fortunei, 11 April 2024, Y.R. Xiong, XG394 (MHZU 24-0489, new host and new geography record), living culture ZHKUCC 25-0051, other living culture ZHKUCC 25-0052.
GenBank numbers: ZHKUCC 25-0051: ITS – PV578272, LSU – PV578440; ZHKUCC 25-0052: ITS – PV578273, LSU – PV578441.
Notes: In the phylogenetic analysis, our collection clustered with Vi. nigra by 87% ML bootstrap support and 1.00 BYPP (Fig. 125). Based on a MegaBLAST (Query cover ≥ 70%) search using the ITS and LSU sequence, the closest matches in the NCBI GenBank nucleotide database were V. nigra (GenBank AB670716; similarity 604/608(99%), 1 gap), V. nigra (GenBank AB670711; similarity 603/608(99%), 1 gap) and Vi. nigra (GenBank: MN844242; similarity 599/606(99%), 2 gaps) for ITS; Vi. nigra (GenBank MH866907; similarity 884/887(99%), 1 gap), V. nigra (GenBank MH870170; similarity 880/889(99%), 3 gaps) and V. nigra (GenBank: MH871129; similarity 879/888(99%), 2 gaps) for LSU. Morphological evidence of conidiogenous cells and brown conidia fits well with Vi. nigra (Liu et al. 2024a, Fig. 126). Virgaria nigra have been recorded from different hosts worldwide (Matsushima 1975, Hughes 1978, Seifert et al. 2011, Nonaka et al. 2013, Liu et al. 2024a). Some studies have indicated that V. nigra has the potential to produce novel antimicrobial metabolites (Ishii et al. 2012). Based on morphology and phylogenetic analysis, we identified our collection as a new geographical and host record of V. nigra from Trachycarpus fortunei in China.
Xylariales genera Incertae sedis
Anthostomella Sacc., Atti Soc. Veneto-Trent. Sci. Nat., Padova, Sér. 4 4: 84 (1875)
Saccardo (1875) established Anthostomella to accommodate A. limitata, A. tomicoides and A. perfidiosa, without designated type. Eriksson (1966) designated A. limitata as the type species based on its non-appendiculate ascospores. However, Francis (1975) argued that the lack of a clypeus in A. limitata was inconsistent with Anthostomella and subsequently redesignated A. tomicoides as the type species. Although Lu & Hyde (2000) reported the presence of a dark clypeus in Anth. limitata, they accepted A. tomicoides as the type species. Anthostomella is a polyphyletic genus characterized by immersed ascomata beneath a dark clypeus, periphysate ostiolar canals, unitunicate, cylindrical asci with or without a J+, apical ring and mostly brown, aseptate ascospores with or without a dwarf cell or appendages at the ends and presence or absence of a germ slit (Lu & Hyde 2000, Daranagama et al. 2015, Samarakoon et al. 2022). Daranagama et al. (2015) revised the genus based on morphology and phylogenetic analysis of combined ITS, rpb2, tub2 and LSU. Subsequently, Samarakoon et al. (2022) re-evaluated and revised Anthostomella based on morphological characteristics and phylogenetic analyses incorporating combined ITS, LSU, SSU, rpb2, tub2, and tef1-α sequence data, which is followed in this study to update the phylogenetic tree of Anthostomella (Fig. 127). Currently, 179 epithets are listed under Anthostomella (Index Fungorum, 2025 July), and only 16 species have molecular data. Among these, 82 species (about 45% of the species in this genus) have been reported from palms, including two new species described in this study (Supplementary Table 1).
Anthostomella chinensis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 129
Index Fungorum number: IF 904954; Facesoffungi number: FoF 19257
Etymology: Refers to the host species name “chinensis”, from which the species was collected.
Saprobic on dead leaf sheath of Livistona chinensis. Asexual morph: Not observed. Sexual morph: Ascomata 150–180 × 180–200 μm (x̅ = 160 × 190 μm, n = 10), sub-immersed, scattered or gregarious, solitary, raising host epidermal and producing a black area, with a poorly developed clypeus, papillate, subglobose to globose in vertical section. Ostioles centric, ostiolar canal periphysate. Peridium 10–20 μm wide, multi-layered, attached to the host with yellowish to hyaline, outer layer comprising brown, thick-walled cells of textura angularis. Paraphyses 2.5–3.5 μm wide, hypha-like, flexuose, numerous, unbranched, without septa, guttulate. Asci 60–90 × 8–10 μm (x̅= 84 × 9 μm, n = 30), 8-spored, unitunicate, long-cylindrical, short pedicellate, apex rounded, with a discoid apical apparatus. Ascospores 10–13 × 5–6.5 μm (x̅ = 11.4 × 5.7 μm, n = 25), uniseriate, unicellular, with broadly rounded ends, with straight germ slit, brown, fusiform or ellipsoidal, smooth, surrounded by a thin mucilaginous sheath, lacking appendages.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, irregular, floccose, lobate edge, dusty green with grey marge; in reverse dark brown.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Qujing City, Sanyuan District, on dead leaf sheath of Livistona chinensis, 29 Dec 2022, Y.R. Xiong and L. Lu, XG137 (MHZU 23-0130, holotype), ex-type ZHKUCC 24-0067, other ex-type living culture ZHKUCC 24-0068.
GenBank numbers: ZHKUCC 24-0067: ITS – PV578130, LSU – PV578300, SSU – PV578484, tef1-α – PV608814, rpb2 – PV595302, tub2 – PV584053; ZHKUCC 24-0068: ITS – PV578131, LSU – PV578301, SSU – PV578485, tef1-α – PV608815, rpb2 – PV595303, tub2 – PV584054.
Notes: In the phylogenetic analysis of Xylariales our collections clustered in Anthostomella clade and formed a sister lineage with Anthostomella foliatella with 100% ML bootstrap support and 1.00 BYPP. The nucleotide differences (excluding gaps) between A. chinensis (ZHKUCC 24-0067) and A. foliatella (MFLUCC 18-0459) were checked and given as follows, ITS: 4.75% (27/568 base pairs), LSU: 1.25% (14/1117 base pairs), SSU: 0% (1/1014 base pairs), rpb2: 5.26% (53/1007 base pairs), tub2: 8.09% (66/816 base pairs), tef1-α: 8.18% (77/941 base pairs). Anthostomella chinensis has fusiform or ellipsoidal conidia surrounded by a thin mucilaginous sheath, while A. foliatella has oblong-ellipsoidal to ellipsoid-fusiform conidia with ends acute and without a sheath (Zhang et al. 2024, Fig. 128). Based on phylogenetic placement and morphological variations, we introduce A. chinensis as a new species.
Anthostomella umbraculiferae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 128
Index Fungorum number: IF 904955; Facesoffungi number: FoF 19258
Etymology: Refers to the host species Corypha umbraculifera, from which the species was collected.
Saprobic on dead petiole of Corypha umbraculifera. Asexual morph: Coelomycetous. Conidiomata 130–270 × 100–250 μm (x̅ = 200 × 175 μm, n = 10), pycnidial, semi-immersed, solitary, globose to pyriform, unilocular, ostioles, Papillate structure with a centrally depressed apex. Clypeus thick, comprising host cells mixed with dark-brown intracellular fungal hyphae. Peridium 15–30 μm, composed of thick-walled, dark-brown cells, textura angularis, inner wall with hyaline cells. Conidiophores reduced to conidiogenous cells. Conidiogenous cell 5–10 × 2–3 μm (x̅ = 7 × 2.3 μm, n = 25), enteroblastic, tretic (pores), phialidic to cylindrical, hyaline, smooth-walled. Conidia 10–11.5 × 5–6 μm (x̅ = 10.9 × 5.6 μm, n = 25), unicellular, dark brown to black, brown, ovate or ellipsoidal-inequilaterally ellipsoidal, smooth, with broadly rounded ends, with a slightly oblique germ slit running longitudinally, a separation pore at base, lacking appendages and sheaths. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, velvety, milky white to yellowish white; in reverse cream in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead petiole of Corypha umbraculifera, 5 Feb 2023, Y.R. Xiong and L. Lu, XG145 (MHZU 25-1053, holotype), ex-type ZHKUCC 25-0085, other ex-type living culture ZHKUCC 25-0086.
GenBank numbers: ZHKUCC 25-0085: ITS – PV578132, LSU – PV578302, rpb2 – PV595304, tef1-α – PV608816; ZHKUCC 25-0086: ITS – PV578133, LSU – PV578303, rpb2 – PV595305, tef1-α – PV608817.
Notes: Our collections formed a sister lineage with Anthostomella pseudobirima in the phylogenetic tree with 100% ML bootstrap support and 1.00 BYPP. The nucleotide differences (excluding gaps) between A. umbraculiferae (ZHKUCC 25-0085) and A. pseudobirima (GZCC 21-0199) were checked and given as follows: ITS: 5.35% (30/561 base pairs), LSU: 0.55% (5/912 base pairs), rpb2: 9.21% (96/1043 base pairs), and tef1-α: 5.74% (54/940 base pairs). Morphologically, A. umbraculifera has conidia that are dark brown to black brown and ovate or ellipsoidal-inequilaterally ellipsoidal, which fits with Anthostomella (Li et al. 2024). However, A. umbraculiferae is distinct in Anthostomella, which has conidia with a slightly oblique germ slit running longitudinally and a separation pore at the base. Moreover, A. pseudobirima is a sexual morph which cannot be compared with A. umbraculiferae (Zhang et al. 2024). Based on phylogenetic placement and morphological variations, we introduce A. umbraculiferae as a new species.
Calamomyces Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Index Fungorum number: IF 904956; Facesoffungi number: FoF 19259
Etymology: Refers to the host genus Calamus from which type species was collected
Type species: Calamomyces brunneisporus Y.R. Xiong, Manawas. & K.D. Hyde
Saprobic on dead substrates. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, irregular, effuse, hairy, velvety, black. Mycelium mostly immersed in substratum, consisting of branched, septate, brown, smooth hyphae. Conidiophores macronematous, mononematous, caespitose, cylindrical, unbranched, erect, slightly curved at the median part, smooth, dark brown, septate. Conidiogenous cell monoblastic, holoblastic, terminal, determinate, cylindrical. Conidia acrogenous, solitary, fusiform to fusoid, 1-sepate, slightly constricted at septa, sometime flexuous, guttulate, truncate at base with a pore, rounded at apex, brown to dark brown. Sexual morph: Not observed.
Notes: Based on phylogenetic results (Fig. 120), our collection of Calamomyces, formed a sister clade with Sporidesmium gyrinomorphum in Xylariales. Calamomyces is a hyphomycetous genus which is characterised by macronematous, mononematous and unbranched, erect conidiophores. In addition, Calamomyces has conidia characterised by fusiform to fusoid, truncate at the base with a pore, rounded at the apex, and 1-septate. It differs from Sporidesmium gyrinomorphum, which has rostrate conidia, 7–8-euseptate and obclavate to obspathulate (Yang et al. 2018b). Although Sporidesmium belongs to Sporidesmiaceae (Sporidesmiales), Yang et al. (2018b) placed Sporidesmium gyrinomorphum within Sporidesmium sensu lato according to its distinctive conidiophores, cylindrical conidiogenous cells with percurrent proliferation and obclavate, rostrate conidia. Our collections were also distinctive in Xylariales by unbranched conidiophores, determinate conidiogenous cells, and conidia truncate at the base with a pore, acrogenous with 1-sepate (Fig. 130). Based on morphological variation and phylogenetic results, we propose a monotypic genus Calamomyces, to accommodate the type species C. brunneisporus. However, we provisionally treat it as Xylariales incertae sedis, given its closest phylogenetic relationship to Sporidesmium gyrinomorphum. More fresh collections of Calamomyces are needed to establish a stable placement of this genus in Xylariales.
Calamomyces brunneisporus Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 130
Index Fungorum number: IF 904957; Facesoffungi number: FoF 19260
Etymology: Refers to the brown to dark brown conidia.
Saprobic on dead leaf sheath of Calamus sp. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, irregular, effuse, hairy, velvety, black. Mycelium mostly immersed in substratum, consisting of branched, septate, brown, smooth hyphae. Conidiophores 80–100 × 5.5–8.5 μm (x̅ = 93 × 6.7 μm, n = 15), macronematous, mononematous, caespitose, cylindrical, unbranched, erect, slightly curved at the medium part, smooth, dark brown, septate. Conidiogenous cells 15–20 × 4–5 μm (x̅ = 16.8 × 4.6 μm, n = 25), monoblastic, holoblastic, terminal, determinate, cylindrical. Conidia 20–30 × 5–6 μm (x̅ = 23 × 5.8 μm, n = 25), acrogenous, solitary, fusiform to fusoid, 1-sepate, slightly constricted at septa, sometime flexuous, guttulate, truncate at base with a pore, rounded at apex, brown to dark brown. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, circular, margin entire, dense, grey mycelium velvety towards the margin; reverse dark at the center, grey in the margin.
Known distribution: Thailand (this study).
Material examined: Thailand, Narathiwat Province, in an unidentified beach, on dead petiole of Calamus sp., 6 Aug 2024, Y.R. Xiong, XG332 (MFLU 25-0148, holotype), ex-type MFLUCC 25-0206, other ex-type living culture MFLUCC 25-0207.
GenBank numbers: MFLUCC 25-0206: ITS – PV578142, LSU – PV578312, tef1-α – PV608824; MFLUCC 25-0207: ITS – PV578143, LSU – PV578313, tef1-α – PV608825.
Notes: Our collection developed a sister clade with Sporidesmium gyrinomorphum in the phylogenetic tree with 100% ML bootstrap support and 1.00 BYPP (Fig. 120). Based on a MegaBLAST (Query cover ≥ 70%) search using the LSU sequence, the closest matches in the NCBI GenBank nucleotide database were Xyladictyochaeta lusitanica (GenBank MH107972; similarity 816/844 (96.68%), 0 gap), Ellisembia calyptrata (GenBank DQ408564; similarity 817/846 (96.57%), 2 gaps) and Pseudophloeospora eucalypti (GenBank HQ599593; similarity 835/866 (96.42%), 2 gaps). The highest similarities using the ITS sequence were Xylaria hypoxylon (GenBank MH864103; similarity 490/595 (82.35%), 47 gaps), Xylaria adscendens (GenBank KP133287; similarity 504/613 (82.22%), 42 gaps) and Xylaria schweinitzii (GenBank KP133459; similarity 488/594 (82.15%), 37 gaps). The highest similarities using the tef1-α sequence were Sporidesmium gyrinomorphum (GenBank MF135656; similarity 874/933 (93.68%), 0 gap) and Stilbochaeta novae-guineensis (GenBank OL654060; similarity 882/968 (91.12%), 3 gaps), Codinaea assamica (GenBank OL653997; similarity 877/964 (90.98%), 2 gaps). Calamomyces brunneisporus is distinct by having monoblastic and terminal conidiogenous cells, conidia 1-sepate, slightly constricted at septa, sometimes flexuous, brown to dark brown. Based on phylogenetic placement and morphological variations, we introduce C. brunneisporus as a new species.
Melanographium Sacc., Annls mycol. 11(6): 557 (1913)
Saccardo (1913) established Melanographium with M. spleniosporum as the type species. Melanographium is a hyphomycetous genus characterized by superficial colonies or arising in a group from immersed stromata, unbranched conidiophores; polyblastic conidiogenous cells with sympodial proliferation; holoblastic, reniform conidia, aseptate, frequently reniform and often with a hyaline germ slit (Ellis 1963, 1971). Length of conidiophores, pattern of conidiophore grouping (single, synnemata, or loosely or densely fasciculate), conidial shape (straight, curved, or strongly curved), and conidial size are morphological traits of the identified species in this genus (Goh & Hyde 1997, Somrithipol & Jones 2005). Hyde et al. (2020b) provided molecular data (ITS, LSU, SSU, and tef1-α) for Melanographium and, based on morphological evidence and phylogenetic analysis of combined ITS, LSU, SSU, rpb2, tub2,1-α and tef1-α, placed it in Xylariales. Subsequently, phylogenetic studies mainly used SSU, LSU, tef1-α and rpb2 or without SSU for analysis (Liu et al. 2024a, Zhang et al. 2024), and this study used ITS, LSU, SSU and tef1-α to update Melanographium phylogeny (Fig. 131). Fourteen epithets are listed under Melanographium (Index Fungorum, 2025 July), and only five species have molecular data. Thirteen species (about 81% of the species in this genus) have been reported from palms, including two new species and one new geographical record described in this study (Supplementary Table 1).
Melanographium citri (Gonz. Frag. & Cif.) M.B. Ellis, Mycological Papers 93: 21 (1963). Fig. 132
Index Fungorum number: IF 333903
Saprobic on dead leaf sheath of Trachycarpus fortunei. Asexual morph: Hyphomycetous. Colonies on natural substratum superficial, effuse, velvety or tufted, black. Mycelium immersed. Conidiophores 170–320 × 4–6 μm (x̅ = 294 × 4.7 μm, n = 15), fasciculate, macronematous, mononematous, unbranched, usually straight, flexuous and sometimes slightly swollen near the medium, septate, forming moderately dense, dark brown fascicles, often paler and spreading in the upper part, smooth. Conidiogenous cells polyblastic, integrated, terminal, cylindrical, subhyaline to pale brown, smooth-walled. Conidia 16–20 × 10–14 μm (x̅ = 17.8 × 11.5 μm, n = 25), solitary, curved, smooth or verrucose, reniform, integrated, terminal, often with a longitudinal germ slit, pale to dark brown, aseptate. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, sparse, white mycelium on the surface with entire margin; in reverse yellow in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, on dead leaf sheath of Trachycarpus fortunei, 5 Feb 2023, Y.R. Xiong and L. Lu, XG277 (MHZU 23-0189, new geography record), living culture ZHKUCC 24-0185, other living culture ZHKUCC 24-0186.
GenBank numbers: ZHKUCC 24-0185: ITS – PV578196, LSU – PV578364, SSU – PV578510, tef1-α – PV608858; ZHKUCC 24-0186: ITS – PV578197, LSU – PV578365, SSU – PV578511, tef1-α – PV608859.
Notes: In the phylogenetic tree, our collection clustered with Melanographium citri with 100% ML bootstrap support and 1.00 BYPP (Fig. 131). Nucleotide differences (excluding gaps) between the strain obtained in this study (ZHKUCC 24-0185) and Melanographium citri (GZCC 21-0208) were checked and given as follows, ITS: 0% (0/564 base pairs), LSU: 0% (1/846 base pairs), SSU: 0% (0/1001 base pairs), and tef1-α: 3.43% (1/933 base pairs). Morphologically, the strains fit well with M. citri, which have solitary, curved conidia, often with a longitudinal germ slit (Prasher & Verma 2016, Zhang et al. 2024). The conidiophores in our collections are shorter than those reported for M. citri (170–320 μm vs. 800 μm–1200 μm); the differences may be due to local habitat or environmental factors (Ellis 1963, Zhang et al. 2024). This is the first report of M. citri from Xishuangbanna City. Based on phylogenetic placement and morphological variations, we introduce our collections as a new geographical record of M. citri.
Melanographium coryphae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 133
Index Fungorum number: IF 904958; Facesoffungi number: FoF 19261
Etymology: Refers to the host genus Corypha, from which the species was collected.
Saprobic on dead petiole of Corypha umbraculifera. Asexual morph: Hyphomycetous. Colonies on natural substratum superficial, effuse, velvety or tufted, black. Mycelium superficial, conidia adhering in clusters, composed of hyaline to pale brown, smooth, hyphae. Conidiophores 220–420 × 4–7 μm (x̅ = 298 × 5.5 μm, n = 15), 3–5 in loose flared fascicle or rarely single, straight or flexuous, with Z-shape proliferation near apex, brown below, paler near apex, multi-septate, smooth. Conidiogenous cells holoblastic, integrated, terminal, pale brown, smooth-walled. Conidiogenous cells polyblastic, integrated, terminal, cylindrical, subhyaline to pale brown, smooth-walled. Conidia 14–18 × 11–15 μm (x̅ = 16 × 12.5 μm, n = 25), holoblastic, slightly curved, aseptate, guttulate, verruculose, smooth, with a subhyaline longitudinal germ-slit. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA, after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface with entire margin; in reverse yellow in the middle and white at the margin.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead petiole of Corypha umbraculifera, 5 Feb 2023, Y.R. Xiong and L. Lu, XG149 (MHZU 23-0133, holotype), ex-type ZHKUCC 24-0073, other ex-type living culture ZHKUCC 24-0074.
GenBank numbers: ZHKUCC 24-0073: ITS – PV578198, LSU – PV578366, SSU – PV578512, tef1-α – PV608860; ZHKUCC 24-0074: ITS – PV578199, LSU – PV578367, SSU – PV578513, tef1-α – PV608861.
Notes: In the phylogenetic analysis of Melanographium, our collection formed an independent lineage with 100% ML bootstrap support and 1.00 BYPP (Fig. 131). The nucleotide differences (excluding gaps) between M. coryphae (ZHKUCC 24-0073) and its phylogenetically related species were checked and given as follows, M. citri (GZCC 21-0208) - ITS: 8.98% (51/568 base pairs), LSU: 1.98% (17/860 base pairs), SSU: 0.39% (4/1001 base pairs), and tef1-α: 6.44% (60/932 base pairs); M. elaeis (ZHKUCC 24-0117) - ITS: 8.78% (49/558 base pairs), LSU: 2.29% (20/870 base pairs), SSU: 0.39% (4/1025 base pairs), and tef1-α: 7.58% (73/963 base pairs); M. selenioides (GZCC 21-0246) - ITS: 5.37% (29/540 base pairs), LSU: 1.63% (14/861 base pairs), SSU: 0.39% (4/1010 base pairs), and tef1-α: 5.61% (51/909 base pairs). Melanographium coryphae differs from its closely related species by conidia adhering in clusters to the mycelium and having Z-shaped proliferation near the apex of the conidiophore. Based on phylogenetic placement and morphological variations, we introduce our collection as a new species.
Melanographium elaeidis Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 134
Index Fungorum number: IF 904959; Facesoffungi number: FoF 19262
Etymology: Refers to the host genus Elaeis, from which the species was collected.
Saprobic on dead segment of Elaeis guineensis. Asexual morph: Hyphomycetous. Colonies on natural substrate superficial, effuse, velvety, tufted, dark brown. Mycelium immersed, composed of smooth, pale brown hyphae. Conidiophores 300–400 × 4.5–7 μm (x̅ = 346 × 5.7 μm, n = 15), macronematous, densely, fascicle or tufted, unbranched, multiseptate, erect, straight or broadly curved, brown at base, paler towards the apex. Conidiogenous cells polyblastic, integrated, terminal and intercalary, cylindrical, subhyaline to pale brown, smooth. Conidia 15–20 × 11–13 μm (x̅ = 17.5 × 12.5 μm, n = 25), solitary, simple, olivaceous brown to brown, frequently reniform, aseptate, rough-walled, verrucose, with a germ slit running longitudinally. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 4 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface with entire margin; in reverse white.
Known distribution: China (this study).
Material examined: China, Yunnan Province, Xishuangbanna City, in an unidentified forest beside National Highway 219, on dead rachis of Elaeis guineensis, 5 Feb 2023, Y.R. Xiong and L. Lu, XG195 (MHZU 23-0155, holotype), ex-type ZHKUCC 24-0117, other ex-type living culture ZHKUCC 24-0118.
GenBank numbers: ZHKUCC 24-0117: ITS – PV578200, LSU – PV578368, SSU – PV578514, tef1-α – PV608862; ZHKUCC 24-0118: ITS – PV578201, LSU – PV578369, SSU – PV578515, tef1-α – PV608863.
Notes: In the phylogenetic analysis, our collection formed a separate lineage with Melanographium citri with 84% ML bootstrap support and 1.00 BYPP (Fig. 131). The nucleotide differences (excluding gaps) between M. elaeidis (ZHKUCC 24-0117) and M. citri (GZCC 21-0208) were checked and given as follows, ITS: 2.48% (14/564 base pairs), LSU: 0.23% (2/884 base pairs), SSU: 0% (0/1001 base pairs), and tef1-α: 2.36% (22/933 base pairs). Morphologically, M. elaeidis has terminal and intercalary conidiogenous cells, while M. citri and M. coryphae have only terminal cells (Ellis 1963, Zhang et al. 2024, this study). Based on phylogenetic placement and morphological variations, we introduce M. elaeidis as a new species.
Sordariomycetes families Incertae sedis
Leucocellomycetaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Index Fungorum number: IF 904960; Facesoffungi number: FoF 19263
Etymology: Refers to the name of the type genus.
Type genus: Leucocellomyces Y.R. Xiong, Manawas. & K.D. Hyde
Saprobic on dead substrates. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, hairy, punctiform. Mycelium partly immersed in substratum, consisting of branched hyphae. Conidiophores macronematous, mononematous, unbranched, erect to flexuous, dark olive-brown to subhyaline, septate, proliferating, constricted at remnants of proliferation, smooth. Conidiogenous cells monoblastic, integrated, terminal, determinate, light coloured, septum at the junction of conidiogenous cell with conidiophore constricted. Conidia solitary, fusiform, globose to subglobose, septate, smooth-walled, guttulate. Sexual morph: Not observed.
Notes: Leucocellomycetaceae is introduced and typified by Leucocellomyces, which forms a sister clade with Acrodictyaceae in Diaporthomycetidae (Sordariomycetes) (Fig. 135). Leucocellomycetaceae and Acrodictyaceae both have macronematous, mononematous conidiophores that sometimes proliferate (Xia et al. 2017, Yu et al. 2024). However, in Leucocellomycetaceae the conidiogenous cell is paler than the conidiophore, and the septum at the junction of the conidiogenous cell with the conidiophore is constricted, features not observed in Acrodictyaceae (Xia et al. 2017, Fig. 135). Acrodictyaceae is a family incertae sedis in Diaporthomycetidae (Yu et al. 2024). We propose Leucocellomycetaceae as a new family incertae sedis in Diaporthomycetidae (Sordariomycetes).
Leucocellomyces Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Index Fungorum number: IF 904961; Facesoffungi number: FoF 19264
Etymology: Refers to the light coloured conidiogenous cell characteristic and hyaline apical cell of the type species
Type species: Leucocellomyces licualae Y.R. Xiong, Manawas. & K.D. Hyde
Saprobic on dead substrates. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, hairy, velvety, gregarious. Mycelium mostly immersed in substratum, consisting of branched, septate, smooth hyphae. Conidiophores macronematous, mononematous, single to caespitose, cylindrical, unbranched, erect to slight curved, dark olive-brown, light olive to hyaline at the apex, septate, percurrently proliferating, not constricted at the septa, constricted at remnants of proliferation, smooth. Conidiogenous cells monoblastic, integrated, terminal, cylindrical, septum at the junction of conidiogenous cell with conidiophore constricted, often with localized swelling, light olive to hyaline at the apex, percurrently proliferating. Conidia solitary, fusiform, 1-septate, olive to dark brown, truncate conidiogenous loci with pore, basal cell erect and short, upper cell tapering and pointed, slightly bent to geniculate and long, guttulate. Sexual morph: Not observed.
Notes: In our phylogenetic result (Fig. 135), Leucocellomyces clustered with Acrodictys. Although they have similar conidiophore morphology, they differ in conidial and conidiogenous cell morphology (Xia et al. 2017). Leucocellomyces has conidia which are 1-septate, basal cell erect, and short, upper cell tapering and pointed, slightly bent to geniculate and long, while Acrodictys has conidia with both transverse and longitudinal septa, the transverse septa typically spanning the whole conidial width, the longitudinal septa incomplete and short (Xia et al. 2017). According to morphological differences and phylogenetic results, we propose the genus Leucocellomyces to accommodate the type species L. licualae.
Leucocellomyces licualae Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 136
Index Fungorum number: IF 904962; Facesoffungi number: FoF 19265
Etymology: Refers to the host genus Licuala, from which the species was collected.
Saprobic on dead petiole of Licuala sp. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, black, hairy, velvety, gregarious. Mycelium mostly immersed in substratum, consisting of branched, septate, pale brown to brown, smooth hyphae. Conidiophores 70–190 × 4–5.5 μm (x̅ = 143 × 4.7 μm, n = 15), macronematous, mononematous, single to caespitose, cylindrical, unbranched, erect to slight curved, dark olive-brown, light olive to hyaline at the apex, septate, percurrently proliferating, not constricted at septa, constricted at remnants of proliferation, smooth. Conidiogenous cells 20–30 × 4–4.5 μm (x̅ = 21.6 × 4.3 μm, n = 25), monoblastic, integrated, terminal, cylindrical, septum at the junction of conidiogenous cell with conidiophore constricted, often with localized swelling, light olive to hyaline at the apex, percurrently proliferating. Conidia 30–40 × 5.5–6.5 μm (x̅ = 33.5 × 5.9 μm, n = 25), fusiform, 1-septate, olive to dark brown, truncate conidiogenous loci with pore, basal cell erect and short, upper cell tapering and pointed, slightly bent to geniculate and long, guttulate. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, circular, margin entire, raised, surface dense filamentous; reverse cream at the margin, dark in the center.
Known distribution: Thailand (this study).
Material examined: Thailand, Narathiwat City, Toh Daeng Peat Swamp Forest, on dead petiole of Licuala sp., 4 Aug 2023, Y.R. Xiong, XG321 (MFLU 25-0144, holotype), ex-type MFLUCC 25-0198, other ex-type living culture MFLUCC 25-0199.
GenBank numbers: MFLUCC 25-0198: LSU – PV578358, SSU – PV578508; MFLUCC 25-0199: LSU – PV578359, SSU – PV578509.
Notes: Our collection from Thailand formed a separate lineage in Sordariomycetes phylogenetic tree with 90% ML bootstrap support and 1.00 BYPP (Fig. 135). Based on a MegaBLAST (Query cover ≥ 70%) search using the LSU sequence, the closest matches in the NCBI GenBank nucleotide database were Pararamichloridium verrucosum (GenBank MH873621; similarity 844/897 (94.09%), 7 gaps), Pseudoproboscispora caudae-suis (GenBank MH868307; similarity 833/887 (93.91%), 6 gaps), and Cancellidium applanatum (GenBank NG_064107; similarity 839/894 (93.85%), 4 gaps). The highest similarities using the SSU sequence were Acrodictys pyriformis (GenBank PQ066568; similarity 743/813 (98.48%), 1 gap), Papulosa amerospora (GenBank AF064050; similarity 830/912 (98.43%), 2 gaps) and Acrodictys pyriformis (GenBank NG_242861; similarity 838/924 (98.43%), 2 gaps). The highest similarities using the ITS sequence were Acrodictys sp. (GenBank MH267821; similarity 469/563 (83.30%), 34 gaps) and Lecythophora sp. (GenBank JX910080; similarity 478/575 (83.13%), 42 gaps), Acrodictys sp. (GenBank ON606324; similarity 474/572 (88.56%), 34 gaps). Leucocellomyces licualae has distinct conidiophores that are constricted at remnants of proliferation, conidiogenous cell septate at the junction of conidiogenous cells with conidiophore constricted and often with localized swellings, conidia 1-septate, olive to dark brown, and truncate conidiogenous loci with a pore. Which differs from Acrodictys, which has conidia with both transverse and longitudinal septa (Xia et al. 2017). Based on phylogenetic separate placement and morphological variation, we introduce L. licualae as a new species.
Junewangiaceae J.W. Xia & X.G. Zhang, Scientific Reports 7: 12 (2017)
Sporidesmiella P.M. Kirk, Transactions of the British Mycological Society 79 (3): 479 (1982)
Kirk (1982) established Sporidesmiella with S. claviformis as the type species. Sporidesmiella is a hyphomycetous genus characterized by conidiophores that are macronematous, mononematous and branched or unbranched, conidiogenous cells monoblastic or polyblastic and enteroblastic, percurrent, elongated, conidia acrogenous or acropleurogenous and mostly distoseptate (Kirk 1982, Luo et al. 2019). Based on morphology and combined SSU, LSU, rpb2 and tef1-α phylogeny, Luo et al. (2019) placed Sporidesmiella in Junewangiaceae. Subsequent studies mainly used ITS, LSU, rpb2 and tef1-α in phylogenetic analyses (Yuan et al. 2020, Liu et al. 2024a). In this study, we used ITS, LSU and rpb2 to update the phylogeny of Sporidesmiella (Fig. 137). Fifty species are listed under Sporidesmiella (Index Fungorum, 2025 July), and only 11 species have molecular data. Four species (about 8% of the species in this genus) have been reported from palms, including a new species described in this study (Supplementary Table 1).
Sporidesmiella trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 138
Index Fungorum number: IF 904963; Facesoffungi number: FoF 19266
Etymology: Refers to the host genus Trachycarpus, from which the species was collected.
Saprobic on dead rachis of Trachycarpus fortunei. Asexual morph: Hyphomycetous. Colonies on natural substratum effuse, hairy, yellow-brown to brown, velvety, scattered. Mycelium immersed, composed of smooth, septate, branched, pale brown hyphae. Conidiophores 120–160 × 5–6 μm (x̅ = 143 × 5.8 μm, n = 10), macronematous, mononematous, erect, straight or slightly flexuous, cylindrical, septate, unbranched, smooth, yellow-brown, paler towards the apex. Conidiogenous cells 15–18 × 4–5 μm (x̅ = 16.7 × 4.8 μm, n = 25), integrated, terminal, monoblastic or rarely polyblastic, holoblastic, subhyaline to pale brown, cylindrical, tapering towards apex. Conidia 18–25 × 8–12 μm (x̅ = 21.7 × 10 μm, n = 25), acrogenous, solitary, 3–4-distoseptate, clavate-obclavate, wider and rounded at the apex, uneven width, truncate at base, sometimes flexuous, subhyaline to pale brown, thick-walled, smooth. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 1 cm diam., at 25 °C, circular, with fluffy, dense, white mycelium on the surface with entire margin, PDA surface ochreous; in reverse brown in the middle and cream at the margin.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Pingxiang City, Wugong Mountain National Scenic Area, on dead rachis of Trachycarpus fortunei, 12 Apr 2024, Y.R. Xiong, XG413 (MHZU 24-0494, holotype), ex-type ZHKUCC 25-0061, other ex-type living culture ZHKUCC 25-0062.
GenBank numbers: ZHKUCC 25-0061: ITS – PV578254, LSU – PV578422, rpb2 – PV595362; ZHKUCC 25-0062: ITS – PV578255, LSU – PV578423, rpb2 – PV595363.
Notes: In the phylogenetic analysis, our collection formed a separate lineage with Sporidesmiella yadongensis (KUNCC 24-17996) with 100% ML bootstrap support and 1.00 BYPP (Fig. 137). The nucleotide differences (excluding gaps) between S. trachycarpi (ZHKUCC 24-0061) and S. yadongensis (KUNCC 24-17996) are, ITS: 3.24% (17/524 base pairs), LSU: 0.38% (3/783 base pairs). Morphologically, S. trachycarpi matches the morphological characteristics of Sporidesmiella by conidia that are widened and rounded at the apex, of uneven width, and truncate at the base (Kirk 1982, Luo et al. 2019, Fig. 138). Xu et al. (2025) suggested that Sporidesmiella species can be separated by phylogenetic analyses based on ITS sequence data. Thus, we introduce S. trachycarpi as a new species based on significant molecular variations.
Pseudoconlariaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Index Fungorum number: IF 904964; Facesoffungi number: FoF 19267
Etymology: refers to the name of the type genus.
Type genus: Pseudoconlarium N.G. Liu, K.D. Hyde & J.K. Liu
Saprobic on dead substrates. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, scattered, punctiform. Mycelium partly immersed, partly superficial. Conidiophores micronematous or semi-macronematous, mononematous, septate, branched, flexuous, subhyaline to pale brown. Conidiogenous cell monoblastic, integrated, terminal, subhyaline to pale brown, determinate. Conidia solitary, brown to medium brown, irregularly globose to subglobose, or trapeziform, muriform, obpyriform, constricted at the septa, smooth-walled, thick wall. Sexual morph: Not observed.
Notes: Pseudoconlariaceae is introduced to accommodate the genus Pseudoconlarium, which was previously treated as Diaporthomycetidae (Sordariomycetes), a genus incertae sedis (Hyde et al. 2020c). Pseudoconlariaceae formed a sister branch with Xenospadicoidaceae and were supported by 89% ML bootstrap values within Sordariomycetes (Fig. 135). The phylogenetic result was similar to those of previous analyses by Réblová et al. (2018), Luo et al. (2019), Hyde et al. (2021), and Liu et al. (2024a). Pseudoconlariaceae is distinct from Xenospadicoidaceae by having micronematous or semi-macronematous conidiophores and conidia of irregular shape. However, Xenospadicoidaceae is characterised by conidiophores that are macronematous, mononematous and conidia solitary or in chains (Hernández-Restrepo et al. 2017). Although Pseudoconlariaceae is similar to Conlariaceae in conidia characters of irregularly globose or subglobose, septate, and constricted at the septa (Hyde et al. 2021), they do not share the same ancestral clade. Thus, based on the phylogenetic results and special morphological characters, it is necessary to propose Pseudoconlariaceae to accommodate Pseudoconlarium at a higher taxonomic level.
Pseudoconlarium N.G. Liu, K.D. Hyde & J.K. Liu, Fungal Diversity 100: 191 (2020)
Hyde et al. (2020c) established Pseudoconlarium with P. punctiforme as the type species based on morphological evidence and phylogenetic analysis of combined SSU, LSU, and tef1-α. Due to its unstable phylogenetic placement, the genus was assigned to Diaporthomycetidae (Sordariomycetes) as incertae sedis (Hyde et al. 2020c). Pseudoconlarium is a hyphomycetous genus characterized by punctiform colonies, micronematous or semi-macronematous conidiophores, and subglobose and muriform multiseptate conidia (Hyde et al. 2020c). Our new collection was analyzed using ITS, LSU, SSU, and tef1-α, and we updated the phylogenetic analysis of Sordariomycetes to provide a stable placement for Pseudoconlarium in Sordariomycetes. Pseudoconlarium is a monotypic genus (Index Fungorum, 2025 July), and the accepted species has molecular data. Here, we describe a new species of Pseudoconlarium, the first report from a palm (Supplementary Table 1).
Pseudoconlarium trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 139
Index Fungorum number: IF 904965; Facesoffungi number: FoF 19268
Etymology: Refers to the host genus Trachycarpus” from which the species was collected.
Saprobic on dead primary rachis of Trachycarpus fortunei. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, scattered, punctiform, raised, dark brown to black. Mycelium partly immersed, partly superficial, composed of light brown, septate, branched hyphae. Conidiophores micronematous, mononematous, septate, branched, flexuous, subhyaline to pale brown. Conidiogenous cells 6–9 × 2–4 μm (x̅ = 8 × 3.2 μm, n = 15), monoblastic, integrated, terminal, subhyaline to pale brown, determinate, doliiform. Conidia 25–35 × 15–20 μm (x̅ = 28 × 16.9 μm, n = 25), solitary, medium brown, irregularly globose or subglobose, muriform, obpyriform, slightly constricted at the transverse septum, smooth-walled, thick-walled. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 2 cm diam., at 25 °C, circular, margin entire, dense, cream, mycelium velvety and black towards the margin, cream; reverse black at the margin.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Pingxiang City, Wugong Mountain National Scenic Area, on dead primary rachis of Trachycarpus fortunei, 12 Apr 2024, Y.R. Xiong, XG405 (MHZU 24-0464, holotype), ex-type ZHKUCC 25-0057, other ex-type living culture ZHKUCC 25-0058.
GenBank numbers: ZHKUCC 25-0057: LSU – PV578404, SSU – PV578538; ZHKUCC 25-0058: LSU – PV578405, SSU – PV578539.
Notes: Our collection formed a separate lineage and clustered with P. punctiforme in the phylogenetic tree with 94% ML bootstrap support and 1.00 BYPP (Fig. 135). The nucleotide differences (excluding gaps) between P. trachycarpi (ZHKUCC 25-0057) and P. punctiforme (GZCC 20-0009) were checked and given as follows: ITS: 15.80% (82/519 base pairs), LSU: 5.15% (42/815 base pairs), SSU: 1.86% (19/1021 base pairs), and tef1-α: 9.47% (88/929 base pairs). Pseudoconlarium trachycarpi fits well with P. punctiforme on conidia shape. However, in P trachycarpi trapeziform conidia were not observed, and they were only slightly constricted at the transverse septa, which is different from P. punctiforme, which has trapeziform conidia that are constricted at the septa (Hyde et al. 2020c). Thus, based on significant molecular differences and morphological variation, we introduce P. trachycarpi as a new species.
Sporodochyalomycetaceae Y.R. Xiong, Manawas. & K.D. Hyde, fam. nov.
Index Fungorum number: IF 904966; Facesoffungi number: FoF 19269
Etymology: Refers to the name of the type genus.
Type genus: Sporodochyalomyces Y.R. Xiong, Manawas. & K.D. Hyde
Saprobic on dead substrates. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, scattered, coalescing, punctiform. Mycelium partly immersed, partly superficial. Conidiophores micronematous, reduced to conidiogenous cells. Conidiogenous cells holoblastic, hyaline. Conidia non-complanate, cheiroid, clavate, ellipsoidal, subcylindrical, slightly bent to geniculate, brown to dark brown, acrogenous, smooth-walled, tightly fasciculate, composed of multiple rows of cells, multi-euseptate in each row, rows of cells tapering and converging at the conidial base, each row of cells bears a hyaline, elongated apical cell. Conidial secession: schizolytic. Sexual morph: Not observed.
Notes: Sporodochyalomycetaceae is introduced to accommodate the new genus Sporodochyalomyces, which formed an independent branch with Trichosphaeriaceae within Diaporthomycetidae in Sordariomycetes (Fig. 135). The phylogenetic result was similar to previous phylogenetic analyses (Réblová et al. 2018, Luo et al. 2019, Hyde et al. 2021, Liu et al. 2024a). Sporodochyalomyces is distinct within Diaporthomycetidae by having tightly fasciculate structures composed of multiple rows of cells, each row bearing an elongated apex cell. Although those characteristics are different from hyphomycetous (Brachysporium) morph of Trichosphaeriaceae, which are usually pendulous, clavate, ellipsoidal, fusiform, limoniform, obovoid or pyriform, septate, brown, often with polar cells paler than middle cells (Hyde et al. 2020d). Sporodochyalomyces formed a stable lineage with Brachysporium, which is a genus of Trichosphaeriaceae placed as incertae sedis due to its unclear taxonomic position (Crous et al. 2023). Thus, we propose Sporodochyalomycetaceae as a Diaporthomycetidae family incertae sedis, pending further evidence for re-evaluating its taxonomic placement.
Sporodochyalomyces Y.R. Xiong, Manawas. & K.D. Hyde, gen. nov.
Index Fungorum number: IF 904967; Facesoffungi number: FoF 19270
Etymology: Refers to the conidia characteristic “sporodochium structure” and “hyaline cell at apex” of type species.
Type species: Sporodochyalomyces trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde
Saprobic on dead substrates. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, scattered, coalescing, punctiform, dark brown to black. Mycelium is partly immersed, partly superficial, and composed of septate, branched hyphae. Conidiophores micronematous, reduced to conidiogenous cell. Conidiogenous cell holoblastic, at the base of the spore, hyaline. Conidia non-complanate, cheiroid, clavate, ellipsoidal, subcylindrical, slightly bent to geniculate, brown to dark brown, acrogenous, smooth-walled, and without appendages or mucilaginous sheaths, forming a tightly fasciculate structure, composed of multiple rows of cells, multi-euseptate in each row, slightly constricted at septa, rows of cells tapering and converging at the conidial base, each row of cells bears a hyaline, elongated apical cell, tapering towards the apex, rounded to truncate at apex. Conidial secession: schizolytic. Sexual morph: Not observed.
Notes: Based on our phylogenetic result (Fig. 135), Sporodochyalomyces formed a distinct clade in Sordariomycetes and clustered with Brachysporium. Sporodochyalomyces has micronematous conidiophore or they are reduced to conidiogenous cells and tightly sporodochium structure conidia, while Brachysporium has macronematous, mononematous conidiophores and conidia that are ellipsoid, obovoid, or broadly fusiform (Markovskaja & Treigiené 2007). It also differs from Biflagellospora, which has macronematous, mononematous, erect conidiophores and conidia that are composed of 8–9 cells, consisting of the two upper and larger ones having 4–8 distal tapering arms attached filiform, hyaline appendages (Sivichai & Hywel-Jones 1999). The only species of Biflagellospora with molecular data is Biflagellospora papillata (=Aquidictyomyces appendiculatus) (Dong et al. 2021a, Koukol & Delgado 2021). According to morphological differences, evidence, and phylogenetic results, we propose a monotypic genus Sporodochyalomyces, to accommodate the type species S. trachycarpi. Fresh collections of Sporodochyalomyces are required to better resolve its phylogenetic position within this genus and the family Sporodochyalomycetaceae.
Sporodochyalomyces trachycarpi Y.R. Xiong, Manawas. & K.D. Hyde, sp. nov. Fig. 140
Index Fungorum number: IF 904968; Facesoffungi number: FoF 19271
Etymology: Refers to the host genus Trachycarpus, from which the species was collected.
Saprobic on dead primary rachis of Trachycarpus fortunei, Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, scattered, coalescing, punctiform, raised, dark brown to black. Mycelium partly immersed, partly superficial, composed of light brown, septate, branched hyphae. Conidiophores micronematous, reduced to conidiogenous cell. Conidiogenous cells holoblastic, at the base of the spore, hyaline. Conidia 50–110 × 25–40 μm (x̅ = 76 × 30 μm, n = 25), non-complanate, cheiroid, clavate, ellipsoidal, subcylindrical, slightly bent to geniculate, brown to dark brown, acrogenous, smooth-walled, and without appendages or mucilaginous sheaths, forming a tightly fasciculate structure, composed of multiple rows of cells, 11–18 euseptate in each row, slightly constricted at septa, rows of cells tapering and converging at the conidial base, each row of cells bears a hyaline, elongated apical cell, 10–17 × 2.5–4.5 μm (x̅ = 13.5 × 3.3 μm, n = 25), tapering towards the apex, rounded to truncate at apex. Conidial secession: schizolytic. Sexual morph: Not observed.
Culture characteristics: Colonies on PDA after 2 weeks reaching 1 cm diam., at 25 °C, circular, lobate entire, umbonate, dense, mycelium velvety towards the margin, brown; reverse dark brown at the margin, black in the center.
Known distribution: China (this study).
Material examined: China, Jiangxi Province, Pingxiang City, Wugong Mountain National Scenic Area, on dead primary rachis of Trachycarpus fortunei, 12 Apr 2024, Y.R. Xiong, XG406 (MHZU 24-0465, holotype), ex-type ZHKUCC 25-0059, other ex-type living culture ZHKUCC 25-0060.
GenBank numbers: ZHKUCC 25-0059: ITS – PV578178, LSU – PV578342, tef1-α – PV608848; ZHKUCC 25-0060: ITS – PV578179, LSU – PV578343, tef1-α – PV608849.
Notes: Our collection from Trachycarpus fortunei formed a separate lineage in the phylogenetic tree, with 99% ML bootstrap support and 1.00 BYPP (Fig. 135). Based on a MegaBLAST (Query cover ≥ 70%) search using the LSU sequence, the closest matches in the NCBI GenBank nucleotide database were Cryptadelphia groenendalensis (GenBank AY281104; similarity 859/884 (97.17%), 2 gaps), Brachysporium sp. (GenBank PQ345849; similarity 799/823 (97.08%), 3 gaps) and Cryptadelphia groenendalensis (GenBank EU528007; similarity 863/889 (97.08%), 3 gaps). The highest similarities using the SSU sequence were Xylolentia sp. (GenBank OP378025; similarity 1014/1035 (97.97%), 0 gap), Conlarium aquaticum (GenBank MN994331; similarity 1009/1030 (97.96%), 1 gap) and Conlarium aquaticum (GenBank MN994323; similarity 1008/1029 (97.96%), 1 gap). The highest similarities using the ITS sequence were Pseudoproboscispora caudae-suis (GenBank KU975070; similarity 470/587 (80.07%), 43 gaps) and Longicollum biappendiculatum (GenBank KU975062; similarity 468/589 (79.46%), 44 gaps), Annulusmagnus triseptatus (GenBank OK298393; similarity 463/583 (79.42%), 40 gaps). The highest similarities using the tef1-α sequence were Distoseptispora rostrata (GenBank MG988425; similarity 791/869 (91.02%), 0 gap) and Cancellidium cinereum (GenBank MT370488; similarity 860/952 (90.34%), 2 gaps), Rhodoveronaea nieuwwulvenica (GenBank OQ627955; similarity 791/877 (90.19%), 0 gap). Sporodochyalomyces trachycarpi is distinct by conidia that are ellipsoidal to subcylindrical, slightly bent to geniculate, forming a tightly fasciculate structure, composed of multiple rows of cells, slightly constricted at septa, rows of cells tapering and converging at the conidial base, and each row of cells bears a hyaline, elongated apical cell. Based on phylogenetic placement and morphological variation, we introduce S. trachycarpi as a new species.
Discussion
A rich fungal diversity is essential for maintaining the function and stability of ecosystems (Dighton & White 2017, Grossart et al. 2019, Liu et al. 2022). The unique structure and rich diversity of palms support a huge fungal diversity (Zhang et al. 2024). Studies on palm fungi have flourished over the years, and the diversity, composition, and boundaries of associated fungal species need to be updated to reflect modern fungal taxonomy. To this end, our study provides new taxa and records from cultures to supplement the diversity of palm fungi with new insights into their host preferences. Furthermore, our study also provides new interpretations for predicting the total number of palm fungal, including temporal, spatial and climatic perspectives.
New additions to palm fungi
Our study followed an in-depth investigation of fungal diversity in southern China and the peat swamp regions of southern Thailand and described 80 species based on morphology and phylogenetic analyses. These species are widely distributed across Ascomycota in five classes, 27 orders (including four orders incertae sedis within Dothideomycetes), 50 families, and 66 genera (including one genus incertae sedis in Pleosporales, one in Sordariales, and six in Xylariales). Our findings also indicate that Dothideomycetes and Sordariomycetes are the two largest classes among palm fungi (Pereira & Phillips 2023a, Zhang et al. 2024). In contrast, relevant data on Eurotiomycetes, Leotiomycetes and Orbiliomycetes remain scarce (Figure 141). To ensure adequate sampling and isolation frequency, future research and collection efforts should pay more attention to other fungal groups such as Eurotiomycetes, Leotiomycetes and Orbiliomycetes. In addition, among the 80 species described in this study, only 22 species (28%) were teleomorphs, while 58 species (73%) were anamorphs, including 45 hyphomycetes (56%) and 13 coelomycetes (16%). Our results differ markedly from those reported by Hyde (1997). Their data included 41% teleomorphs, 17% basidiomycetes and 42% anamorphs. Nevertheless, after collating all specimens (including those that did not germinate and those whose fruiting bodies were not in a condition suitable for further research; unpublished data) that we collected over five years, we found that 49% were teleomorphs and 52% were anamorphs. It is evident that the proportion of teleomorph and anamorphic fungi in the overall specimen collection is similar to the results reported by Hyde (1997). The primary factor causing the unbalanced distribution (28% teleomorphs: 72% anamorphs) among the 80 described species is deviation in sample availability. This deviation mainly stems from the fact that pure isolates of the anamorph are relatively easier to obtain under laboratory conditions, whereas the teleomorph not only exhibits a high rate of germination failure but also tends to have its fruiting body contents desiccate too rapidly, making DNA extraction more susceptible to contamination.
Although there is an uneven distribution between teleomorphs and anamorph forms among the 80 species studied and described, these groups clearly illustrate the extensive diversity of palm fungi and the abundance of newly identified fungal lineages. We report 50 new species and 68 new taxa, notably including the first record of 18 fungal genera on palm hosts. Among the specimens analyzed, Trachycarpus fortunei hosted the highest number of species, followed by Livistona chinensis, with the number of samples collected from Trachycarpus fortunei was the largest, greater than for L. chinensis ranking second (Fig. 141). This likely reflects their widespread use as landscape plants in southern China (Mao et al. 2020). Interestingly, some common palm-associated fungal genera such as Linocarpon and Oxydothis, which have mostly been reported from coastal countries or areas (80%) (Hyde 1992, Konta et al. 2016, Supplementary Table 1), were not reported in our study. This might be due to the geographical location where we sampling. Our sampling primarily focused on China, with 59% of samples from tropical climates, but only 16% (13 samples) from Thailand coastal areas. Additionally, the fact that 41% of samples from subtropical regions came from inland or mountainous areas with less favorable secondary habitats is more likely to be the issue.
Nonetheless, we emphasize that the exploration of palm fungal diversity in this study should be further refined. Out of the 604 samples collected (not including all samples), 189 (31%) were challenging to culture on artificial media or to acquire molecular data. Such issues are common in palm fungal research (Konta et al. 2016, 2017). Many of these samples are no longer suitable for ongoing research because they cannot be preserved over time. To prevent wasting palm fungal diversity resources, we recommend that preliminary identification be performed promptly for species lacking molecular data, based on morphological features, and that these specimens be stored in a suitable herbarium. If these fungi cannot be cultivated, direct DNA extraction from samples or direct PCR amplification may prove useful in future studies.
Host recurrence of palm fungi
The relationship between fungi and their hosts is widely discussed in palm fungi. Researchers have used the term “host-specificity” to describe the relationship between fungi and hosts (Hyde 2001, Borah et al. 2018) and have briefly adopted “host-preference” to illustrate this association (Hughes 1981). However, based on their definitions and application scenarios, neither of these two terms is suitable for describing the connection between saprotrophic fungi and their hosts (Zhou & Hyde 2001). Zhou & Hyde (2001) defined host-recurrence as “symbiotic, parasitic, or saprotrophic fungi that occur frequently or predominantly on specific hosts or within a specific host range but also have a small distribution on other hosts in the same habitat” and they suggest that this seems more appropriate for depicting this unique association. Based on the definition of “host-recurrence”, we took palm fungi as a model and provided a new perspective to explain the term, We relied on genera/species with molecular data from our or previous studies, and thus omitted taxa that are unculturable and those without molecular data. Based on our data we propose three terms for palm fungi: “typical palm-recurring genus”, “atypical palm palm-recurring genus”, and “conjectured palm host-recurring genus”.
A “typical palm-recurrence genus” is defined based on two characteristics: (i) over 50% of species in the genus are associated with palms and (ii) more than half of the palm fungal species in the genus cluster together and share the same ancestor in a phylogenetic tree of the genus. For example, Fissuroma is a “typical palm palm-recurring genus”. Fissuroma was proposed to include F. aggregatum from bamboo and F. maculans from palm (Liu et al. 2011). Subsequent studies mostly reported Fissuroma species from palms (Phookamsak et al. 2015, Niranjan & Sarma 2018, Konta et al. 2020). To date, 10 of the 15 Fissuroma species have palm host records (Index Fungorum, 2025 July, Supplementary Table 1). Our phylogenetic results also showed that all Fissuroma species with palm host records clustered in the branch represented by F. maculans (Fig. 18) with 100% ML bootstrap support. Another genus with such a striking palm host preference is Melanographium. To date, 13 of the 16 species of Melanographium have been reported to occur on palm hosts (Index Fungorum, 2025 July, Supplementary Table 1). In our phylogenetic analysis, Melanographium showed clustering of palm-inhabiting species similar to Fissuroma (Fig. 131, 100% ML). Another genus, Fasciatispora was established based on F. nypae from Nypa fruticans (Hyde 1991). This palm preference characteristic has become increasingly prominent as additional species have been described in the genus. To date, 13 of the 15 species of Fasciatispora have been introduced based on palm hosts and have only been reported on palm hosts (Index Fungorum, 2025 July, Supplementary Table 1). The phylogenetic results of Fasciatispora also showed the clustering of palm host groups (Fig. 117). Even though these three examples are good representatives of typical palm-recurring fungal genera, it is important to also consider Oxydothis. The current study lacks fresh collections from Oxydothis. To overcome lack of data for these important genera, we used publicly available data to construct a phylogenetic tree for Oxydothis following Dissanayake et al. (2024b), Cao et al. (2025), and Zhang et al. (2025) (Fig. 142). Currently, 92 out of 100 species have reports of palm hosts, and 91 of these species are only reported on palms (Index Fungorum, 2025 July, Supplementary Table 1). Therefore, Oxydothis also fits well with the conditions of “typical palm-recurring genus”. However, due to the severe lack of molecular data for Linocarpon and Neolinocarpon, additional molecular evidence is required to determine whether they represent a “typical palm-recurring genus”, although data from morphological studies suggests they might be. Furthermore, it is noteworthy that many genera meet the definition of palm host preference in this study, including Phellinocrescentia, Pseudomassarina, Inflatispora, Fusichloridium, Verticimonosporium, Pseudoconiocessia and eight newly introduced genera. However, most of these genera have only two species and are not representative of the study. Therefore, further collections are necessary to understand the relationship of these poorly represented genera.
If a particular genus only fulfils the definition based on the fungal genus perspective (i), the species that use palm trees as a host or one of their hosts account for 25% to 50% of the total number of species in the genus, we call it an “atypical palm palm-recurring genus”. For instance, in Neomassaria, four out of 12 species (33%) have been reported from palms. However, in the phylogenetic analyses these palm fungi are scattered at different positions (Fig. 38). In addition, when constructing a phylogenetic analysis of Neomassaria, we observed that the developmental positions between palm host species were almost all interspersed with species from coffee hosts. This may be caused by host jumping from palm to coffee, as there is clear host-jumping seen in coffee fungi (Lu et al. 2025). In addition, two of the eight (25%) Xylolentia species are from palm trees, and these two species are scattered across different positions in the phylogenetic tree (Fig. 103).
If a particular genus only fulfils the definition based on the phylogenetic perspective (ii), more than half of the palm host fungal species in the genus appear clustered in the phylogenetic results of the genus, we call it a “conjectured palm palm-recurring genus”. For example, with Byssosphaeria and Distoseptispora in this study, more than half of their palm host members clustered in one clade in the phylogenetic results (Fig. 33, Fig. 83).
Palm fungi records from 1990 to 2025 provide new insights into expected fungal diversity
Hawksworth (1991) estimated that there are about 1.5 million species of fungi based on the “fungi-host ratio.” However, Zhou & Hyde (2001) pointed out that this estimate cannot accurately reflect the diversity provided by mycorrhizae and saprobes. Furthermore, our research found that this method depends entirely on the “fungi-host ratio” of the region and uses this as a basis to estimate species diversity. Pereira & Phillips (2023a) predicted palm fungal data by combining multiple previous predictions to provide the “fungi-host ratio,” but they did not fully account for the data aggregation and dispersion deviation caused by host repetition. The scientific community has long acknowledged the crucial role of adopting integrated perspectives and continuous temporal scale frameworks when analyzing species diversity (Steinbauer et al. 2018, Harrison et al. 2020). When considering time and space, regional species diversity and change trends are more accurately reflected (Steinbauer et al. 2018, Harrison et al. 2020). Therefore, to balance data dispersion caused by host repeatability and to fully capture the diversity of palm fungal species, we used a three-phase weighting approach based on time, space, and data dispersion. Using the two discrete opposition models, two different plant-fungal ratios were obtained: 1:17.4 and 1:28.2, respectively (Table 3). The maximum value from this model slightly exceeds the plant:fungi ratio of 1:28 predicted by Hyde (1995, 1996), while the minimum is higher than the 1:8.7 of Taylor et al. (2000). This range-based prediction method may be more adaptable to the dynamic nature of Earth’s ecosystems and help accurately characterize these changes. Even with the minimum value, we estimate there are about 44,500 palm fungal species, but only about 2,000 have been reported (Supplementary Table 1). This indicates that the great potential of palm fungi as a fungal resource library has yet to be further developed.
Analysis of palm fungi records from 1990 to 2025 also exposed the complexity of exploring palm fungi diversity. Although the total number of palm fungi is increasing, the annual number of new additions in the past 15 years has never exceeded the peak reached between 2000 and 2005 (Fig. 1a, Fig. 3). This may be because there are fewer researchers specializing in palm fungi. Secondly, the research area may be too region oriented. There are only eight countries with more than 200 palm records, and even a vast country like Mexico has fewer than 100. This might be due to the geographical spread of researchers and their research limitations. We also found that palm fungi previously identified solely on morphological characteristics are now being correctly classified using molecular data. For example, Hosagoudar & Mathew (2000) first reported Paramarasmius palmivorus (= Marasmius palmivorus) on Phoenix dactylifera based on morphological evidence. Antonín et al. (2023) isolated this species from Elaeis guineensis and obtained its molecular data for the first time, while combining morphological characteristics, formally establishing Paramarasmius and treating Marasmius palmivorus as a synonym of Paramarasmius palmivorus. Subsequently, Arafat (2024) also provided molecular data of Paramarasmius palmivorus on Phoenix dactylifera and supported the conclusion of Antonín et al. (2023) by constructing a phylogenetic tree. In addition, palm fungi in temperate regions are an important part of fungal diversity that cannot be ignored. Palms used in landscape planting are becoming established and naturalized in more temperate areas (Spennemann 2021). Overall, we observed that the number of newly described and recorded palm fungi is increasing each year, whereas the diversity of newly added host species has gradually declined (Fig. 1b). This is not only due to the habitats where palms grow naturally being diminished, but also largely attributed to a limited number of researchers (Xiong et al. 2024).
Conclusions
Palms and their associated fungi constitute one of the most diverse fungal host systems. However, the true diversity of tropical fungi remains to be explored. Progress in species identification and characterization is constrained by limited regional resources, which hampers comprehensive documentation of tropical fungal host associations. In addition, the need to optimally preserve and preliminarily identify many unculturable specimens using morphological characteristics is essential to avoid underestimating the extent of fungal diversity. Although we proposed different types of “palm-recurring genera”, there are still many unsolved mysteries regarding the relationship between palm fungi and their hosts. To address these problems, we suggest: (i) palm fungal taxonomists around the world need to strengthen their connections and explore the vast palm fungi resources in a planned way; (ii) the geographical scope of palm fungi research should be expanded to avoid misjudgment of the expected diversity of palm fungi due to excessive concentration of research areas; (iii) more attention be given to the fungal diversity of temperate and subtropical landscape palms and to prioritize study of palm species where their fungi have not been recorded.
Acknowledgments
Yinru Xiong would like to thank Mae Fah Luang University for awarding a scholarship. We would like to thank Dr Shaun Pennycook, former Nomenclature Editor of Mycotaxon, for his guidance on the species names. This study was supported by High-level Talents at Zhongkai University of Agriculture and Engineering (Grant No. J2201080102), Zhongkai University of Agriculture and Engineering, talent funding (Grant No. KA210319288) and the National Research Council of Thailand (NRCT) (Grant no. N42A650547), entitled “Total fungal diversity in a given forest area with implications towards species numbers, chemical diversity and biotechnology”. Manawasinghe IS thanks the Beijing Academy of Agricultural and Forestry Sciences Foundation for High-Level Talent Recruitment (Grant No. QC2025026). K. D. Hyde and F. Al-Otibi thank the ongoing Research Funding Program (ORF-2026- 114), King Saud University, Riyadh, Saudi Arabia. The authors gratefully acknowledge the late Professor Alan J. L. Phillips for his outstanding contributions to mycology and plant pathology. His significant work on palm-associated fungi provided valuable foundations for the present study.
Author contributions
The authors confirm contribution to the paper as follows: study conception and design: conceptualization, Hyde K.D., Manawasinghe I.S. and Xiong Y.R.; methodology, Hyde K.D., Manawasinghe I.S. and Xiong Y.R.; formal analysis, Manawasinghe I.S. and Mapook A.; resources, Hyde K.D. and Fatimah A.O.; data curation, Lu L. and Xiong Y.R.; writing—original draft preparation, Xiong Y.R.; writing—review and editing, Manawasinghe I.S., Hyde K.D., Mapook A., McKenzie E.H.C., Lu L. and Maharachchikumbura S.N.N.; supervision, Hyde K.D., Manawasinghe I.S.; project administration, Manawasinghe I.S., Hyde K.D., Mapook A. and McKenzie E.H.C.; funding acquisition, Hyde K.D. and Fatimah A.O.
ORCID
Yin-Ru Xiong: https://orcid.org/0000-0002-4673-606X
Kevin D. Hyde.: https://orcid.org/0000-0002-2191-0762
Ishara S. Manawasinghe: https://orcid.org/0000-0001-5730-3596
Conflict of interest statement
The author list includes members of the Editorial Board of Fungal Diversity. They were not involved in the journal’s review of, or decisions related to, this manuscript. The authors declare no competing interests.
Supplementary Information
The online version contains supplemental information available at https://doi.org/10.65390/fdiv.2026.136007. Palm fungi records checklist - 1990 to 2025.xlsx
Rights and permissions
The Author(s) 2026. Published by BioAcademic Press on behalf of Kunming Institute of Botany,Chinese Academy of Sciences (CAS) and Mushroom Research Foundation. This is an open accessarticle under the Creative Commons Attribution license ( http://creativecommons.org/licenses/by/4.0), which permits use, distribution and reproduction in any medium, provided the originalwork is properly cited.
References
- Adams GC, Wingfield MJ, Common R, Roux J. (2005) Phylogenetic relationships and morphology of Cytospora species and related teleomorphs (Ascomycota, Diaporthales, Valsaceae) from Eucalyptus. Studies in Mycology 52:1–144.
- Andersson AMA, Salo J, Mikkola R, Marik T, Kredics L, Kurnitski J, Salonen H. (2021) Melinacidin-producing Acrostalagmus luteoalbus, a major constituent of mixed mycobiota contaminating insulation material in an outdoor wall. Pathogens 10(7):843.
https://doi.org/10.3390/pathogens10070843 - Andreasen M, Skrede I, Jaklitsch WM, Voglmayr H, Nordén B. (2021) Multi-locus phylogenetic analysis of lophiostomatoid fungi motivates a broad concept of Lophiostoma and reveals nine new species. Persoonia - Molecular Phylogeny and Evolution of Fungi 46:240–271.
https://doi.org/10.3767/persoonia.2021.46.09 - Antonín V, Hosaka K, Kolařík M. (2023) Taxonomy and phylogeny of Paramarasmius gen. nov. and Paramarasmius mesosporus, a worldwide distributed fungus with a strict ecological niche. Plant Biosystems - An International Journal Dealing with all Aspects of Plant Biology 157(2):286–293.
- Arafat KH. (2024) Molecular identification of fungal pathogens of date palm root rot in Egypt. Journal of Plant Protection and Pathology 15:155–162.
https://doi.org/10.21608/jppp.2024.283973.1229 - Ariyawansa HA, Jaklitsch WM, Voglmayr H. (2018) Additions to Taiwan fungal flora 1: Neomassariaceae fam. nov. Cryptogamie, Mycologie 39(3):359–372.
https://doi.org/10.7872/crym/v39.iss3.2018.359 - Artigues M, Davet P. (1984) β-(1→3)-glucanase and chitinase activities in some fungi in relation to their capacity to destroy sclerotia of Corticium rolfsii in sterile soil. Soil Biology and Biochemistry 16(5):527–528.
https://doi.org/10.1016/0038-0717(84)90064-6 - Arx JAV, Müller E. (1975) A re-evaluation of the bitunicate Ascomycetes with keys to families and genera. Studies in Mycology 9:1–159.
- Arzanlou M, Groenewald JZ, Gams W, Braun U, Shin HD, Crous PW. (2007) Phylogenetic and morphotaxonomic revision of Ramichloridium and allied genera. Studies in Mycology 58:57–93.
https://doi.org/10.3114/sim.2007.58.03 - Azuddin NF, Mohd MH, Rosely NFN, Mansor A, Zakaria L. (2021) Molecular phylogeny of endophytic fungi from rattan (Calamus castaneus Griff.) spines and their antagonistic activities against plant pathogenic fungi. Journal of Fungi 7:301.
https://doi.org/10.3390/jof7040301 - Badali H, Gueidan C, Najafzadeh MJ, Bonifaz A, Gerrits van den Ende AHG, de Hoog GS. (2008) Biodiversity of the genus Cladophialophora. Studies in Mycology 61:175–191.
https://doi.org/10.3114/sim.2008.61.18 - Baker WA, Partridge EC, Morgan-Jones G. (2001) Notes on Hyphomycetes. LXXXIV. Pseudotrichoconis and Rhexodenticula, two new monotypic genera with rhexolytically disarticulating conidial separating cells. Mycotaxon 79:361–373.
- Bao DF, Hyde KD, McKenzie EHC, Jeewon R, Su HY, Nalumpang S, Luo ZL. (2021) Biodiversity of lignicolous freshwater hyphomycetes from China and Thailand and description of sixteen species. Journal of Fungi 7:669.
https://doi.org/10.3390/jof7080669 - Bao DF, Tian XG, Samarakoon MC, Karunarathna SC, Luo ZL, Han JJ, Wen TC, He ZJ, Liu ZH, Lu YZ, Kang JC. (2025) Biodiversity of lignicolous freshwater fungi from the Nanpan River Basin in Guizhou and Guangxi Provinces, China, with descriptions of fifteen species. Mycosphere 16(1):3695–3752.
https://doi.org/10.5943/mycosphere/16/1/29 - Baral HO, Weber E, Marson G. (2020) Monograph of Orbiliomycetes (Ascomycota) based on vital taxonomy. Part 1 and 2. National Museum of Natural History Luxembourg, 1752 pp.
- Barr ME (1984) Herpotrichia and its segregates. Mycotaxon 20(1): 1–38.
- Barr ME (1990) Melanommatales (Loculoascomycetes). N Am Flora Ser 13: 1–129.
- Beck HE, Zimmermann NE, McVicar TR, Vergopolan N, Berg A, Wood EF. (2018) Present and future Köppen-Geiger climate classification maps at 1-km resolution. Scientific Data 5(1):1–12.
https://doi.org/10.1038/sdata.2018.214 - Bellemère A, Hafellner J. (1982) Ultrastructure des asques de genre Dactylospora (Discomycetes) et son intérêt taxonomique. Cryptogamie, Mycologie 3:71–93.
https://doi.org/10.5962/p.354108 - Bensch K, Braun U, Groenewald JZ, Crous PW. (2012) The genus Cladosporium. Studies in Mycology 72:1–401.
https://doi.org/10.3114/sim0003 - Berkeley MJ, Broome CE. (1850) Notices of British fungi (438–501). Annals and Magazine of Natural History 5:455–466.
https://doi.org/10.1080/03745486009494947 - Bhunjun CS, Niskanen T, Suwannarach N, Wannathes N, Chen YJ, McKenzie EHC, Maharachchikumbura SSN, Buyck B, Zhao CL, Fan YG, et al. (2022) The numbers of fungi: are the most speciose genera truly diverse? Fungal Diversity 114:387–462.
https://doi.org/10.1007/s13225-022-00501-4 - Bhunjun CS, Phukhamsakda C, Hyde KD, McKenzie EHC, Saxena RK, Li Q. (2024) Do all fungi have ancestors with endophytic lifestyles? Fungal Diversity 125:73–98.
https://doi.org/10.1007/s13225-023-00516-5 - Bien S, Damm U. (2020) Arboricolonus simplex gen. et sp. nov. and novelties in Cadophora, Minutiella and Proliferodiscus from Prunus wood in Germany. MycoKeys 63:119–161.
https://doi.org/10.3897/mycokeys.63.46836 - Bispo MGS, Cantillo-Pérez T, Gusmão LFP. (2024) Hyphomycetes occurring on Bambusa vulgaris debris: new species and records from the American continent and Brazil. New Zealand Journal of Botany 62(4):626–640.
https://doi.org/10.1080/0028825X.2024.2310577 - Boehm EW, Schoch CL, Spatafora JW. (2009) On the evolution of the Hysteriaceae and Mytilinidiaceae (Pleosporomycetidae, Dothideomycetes, Ascomycota) using four nuclear genes. Mycological Research 113:461–479.
https://doi.org/10.1016/j.mycres.2008.12.001 - Bondarenko SA, Georgieva ML, Bilanenko EN. (2016) Alkalitolerant micromycetes in acidic and neutral soils of the temperate zone. Microbiology 85:737–744.
https://doi.org/10.1134/S0026261716060035 - Bondarenko SA, Sinitsyna NA, Georgieva ML, Bilanenko EN, Tereshina BM, Ianutsevich EA. (2018) Dynamics of the cytosol soluble carbohydrates and membrane lipids in response to ambient pH in alkaliphilic and alkalitolerant fungi. Microbiology 87:21–32.
https://doi.org/10.1134/S0026261718010034 - Bonifaz A, Davoudi MM, de Hoog GS, Padilla-Desgarennes C, Vazquez-Gonzalez D, Navarrete G, Meis JFGM, Badali H. (2013) Severe disseminated phaeohyphomycosis in an immunocompetent patient caused by Veronaea botryosa. Mycopathologia 175:497–503.
https://doi.org/10.1007/s11046-013-9632-5 - Boonmee S, D’souza MJ, Luo ZL, Pinruan U, Tanaka K, Su HY, Bhat DJ, McKenzie EHC, Jones EBG, Taylor JE, et al. (2016) Dictyosporiaceae fam. nov. Fungal Diversity 80:457–482.
https://doi.org/10.1007/s13225-016-0363-z - Boonmee S, Wanasinghe DN, Calabon MS, Huanraluek N, Chandrasiri SKU, Jones GEB, Rossi W, Leonardi M, Singh SK, Rana S, et al. (2021) Fungal diversity notes 1387–1511: taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Diversity 111:1–335.
https://doi.org/10.1007/s13225-021-00489-3 - Borah N, Albarouki E, Schirawski J. (2018) Comparative methods for molecular determination of host-specificity factors in plant-pathogenic fungi. International Journal of Molecular Sciences 19:863.
https://doi.org/10.3390/ijms19030863 - Borelli D. (1980) Causal agents of chromoblastomycosis (Chromomycetes). In: Proceedings of the 5th International Conference on Mycoses, pp 335–340.
- Bose SK (1961) Studies on Massarina Sacc. and related genera. Phytopath Z 41:151–213.
- Breunig MM, Kriegel HP, Ng RT, Sander J. (2000) LOF: identifying density-based local outliers. In: Proceedings of the 2000 ACM SIGMOD international conference on Management of data, pp 93–104.
https://doi.org/10.1145/342009.335388 - Calabon MS, Jones EBG, Boonmee S, Doilom M, Lumyong S, Hyde KD. (2021) Five novel freshwater ascomycetes indicate high undiscovered diversity in lotic habitats in Thailand. Journal of Fungi 7(2):117.
https://doi.org/10.3390/jof7020117 - Calabon MS, Bagacay JFE, Nim JA, Aposaga DM, Collado GJ, Sadaba RB. (2024) The asexual morph of Seriascoma acutisporum (Occultibambusaceae, Pleosporales). Biology Bulletin:1–8.
https://doi.org/10.1134/S1062359024608334 - Cámara-Leret R, Faurby S, Macía MJ, Balslev H, Göldel B, Svenning JC, Kissling WD, Rønsted N, Saslis-Lagoudakis CH. (2017) Fundamental species traits explain provisioning services of tropical American palms. Nature Plants 3:16220.
https://doi.org/10.1038/nplants.2016.220 - Cao B, Phurbu D, Ralaiveloarisoa A, Liimatainen K, Niskanen T, Ramírez-Cruz V, Bradshaw AJ, Dentinger BTM, Ramírez-Guillén F, et al. (2025) Fungal diversity notes 1919–2016: taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 132(1):425–651.
https://doi.org/10.1007/s13225-025-00556-z - Carbone I, Kohn L. (1999) A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91(3):553–556.
https://doi.org/10.1080/00275514.1999.12061051 - Chandrasiri SKU, Liu YL, Huang JE, Samarakoon MC, Boonmee S, Calabon MS, Hu DM. (2021) Veronaea aquatica sp. nov. (Herpotrichiellaceae, Chaetothyriales, Eurotiomycetes) from submerged bamboo in China. Biodiversity Data Journal 9:e64505.
https://doi.org/10.3897/BDJ.9.e64505 - Chang R, Wang Y, Liu Y, Wang Y, Li S, Zhao G, Zhang S, Dai M, Zheng X, Bose T, Si H. (2023) Nine new species of black lichenicolous fungi from the genus Cladophialophora (Chaetothyriales) from two different climatic zones of China. Frontiers in Microbiology 14:1191818.
https://doi.org/10.3389/fmicb.2023.1191818 - Chethana KWT, Manawasinghe IS, Hurdeal VG, Bhunjun CS, Appadoo MA, Gentekaki E, Raspé O, Promputtha I, Hyde KD. (2021) What are fungal species and how to delineate them? Fungal Diversity 109:1–25.
https://doi.org/10.1007/s13225-021-00483-9 - Chethana KWT, Rathnayaka AR, Samarakoon BC, Wu N, Wijesinghe SN, Yasanthika WAE, Sysouphanthong P, Thiyagaraja V, Armand A, Lestari AS, Madagammana AD, Ediriweera AN, Prematunga C, Li CJY, Tennakoon DS et al. (2023) AJOM new records and collections of fungi: 151–200. Asian Journal of Mycology 6(2):89–243.
https://doi.org/10.5943/ajom/6/2/7 - Ciferri R, Montemartini A. (1957) Sui generi Muchmoria Sacc. e Veronaea n. gen. (Dematiaceae, Didymosporae). Atti dell'Istituto Botanico e del Laboratorio Crittogamico dell'Universita di Pavia Ser 5 15:67–72.
- Clements FE, Shear CL. (1931) The genera of fungi. HW Wilson, New York.
- Cooke MC, Plowright CB (1879) British Sphaeriacei. Grevillea 7:77–89.
- Corda ACJ. (1838) Abbildungen der Pilze und Schwaemme. Icones Fungorum Hucusque Cognitorum 2:1–43.
- Costantin J. (1888) Les mucédinées simples. Paul Klincksieck, Paris, 209 pp.
- Crous PW, Akulov A, Balashov S, Boers J, Braun U, Castillo J, Delgado MA, Denman S, Erhard A, Gusella G, et al. (2023) New and interesting fungi. 6. Fungal Systematics and Evolution 11:109–156.
https://doi.org/10.3114/fuse.2023.11.09 - Crous PW, Luangsa-Ard JJ, Wingfield MJ, Carnegie AJ, Hernández-Restrepo M, Lombard L, Roux J, Barreto RW, Baseia IG, Cano-Lira JF, et al. (2018) Fungal planet description sheets: 785–867. Persoonia - Molecular Phylogeny and Evolution of Fungi 41:238–417.
https://doi.org/10.3767/persoonia.2018.41.12 - Crous PW, Palm ME. (1999) Reassessment of the anamorph genera Botryodiplodia, Dothiorella and Fusicoccum. Sydowia 51:167–175.
- Crous PW, Schubert K, Braun U, de Hoog GS, Hocking AD, Shin HD, Groenewald JZ. (2007) Opportunistic, human-pathogenic species in the Herpotrichiellaceae are phenotypically similar to saprobic or phytopathogenic species in the Venturiaceae. Studies in Mycology 58:185–217.
https://doi.org/10.3114/sim.2007.58.07 - Crous PW, Schumacher RK, Wingfield MJ, Lombard L, Giraldo A, Christensen M, Gardiennet A, Nakashima C, Pereira OL, Smith AJ, Groenewald JZ. (2015) Fungal systematics and evolution: FUSE 1. Sydowia 67:81–118.
https://doi.org/10.12905/0380.sydowia67-2015-0081 - Crous PW, Shivas RG, Quaedvlieg W, van der Bank M, Zhang Y, Summerell BA, Guarro J, Wingfield MJ, Wood AR, Alfenas AC, et al. (2014a) Fungal planet description sheets: 214–280. Persoonia - Molecular Phylogeny and Evolution of Fungi 32:184–306.
https://doi.org/10.3767/003158514X682395 - Crous PW, Slippers B, Wingfield MJ, Rheeder J, Marasas WFO, Philips AJL, Alves A, Burgess T, Barber P, Groenewald JZ. (2006) Phylogenetic lineages in the Botryosphaeriaceae. Studies in Mycology 55:235–253.
https://doi.org/10.3114/sim.55.1.235 - Crous PW, Wingfield MJ, Burgess TI, Carnegie AJ, Hardy GESJ, Smith D, Summerell BA, Cano-Lira JF, Guarro J, Houbraken J, et al. (2017) Fungal planet description sheets: 625–715. Persoonia - Molecular Phylogeny and Evolution of Fungi 39:270–467.
https://doi.org/10.3767/persoonia.2017.39.11 - Crous PW, Wingfield MJ, Burgess TI, Hardy GESJ, Crane C, Barrett S, Cano-Lira JF, Le Roux JJ, Thangavel R, Guarro J, et al. (2016) Fungal planet description sheets: 469–557. Persoonia - Molecular Phylogeny and Evolution of Fungi 37:218–403.
https://doi.org/10.3767/003158516X694499 - Crous PW, Wingfield MJ, Schumacher RK, Summerell BA, Giraldo A, Gené J, Guarro J, Wanasinghe DN, Hyde KD, Camporesi E, et al. (2014b) Fungal planet description sheets: 281–319. Persoonia - Molecular Phylogeny and Evolution of Fungi 33:212–289.
https://doi.org/10.3767/003158514X685680 - Dai DQ, Bahkali AH, Li QR, Bhat DJ, Wijayawardene NN, Li WJ, Chukeatirote E, Zhao RL, Xu JC, Hyde KD. (2014) Vamsapriya (Xylariaceae) re-described, with two new species and molecular sequence data. Cryptogamie, Mycologie 35:339–357.
https://doi.org/10.7872/crym.v35.iss4.2014.339 - Dai DQ, Phookamsak R, Wijayawardene NN, Li WJ, Bhat DJ, Xu JC, Taylor JE, Hyde KD, Chukeatirote E. (2017) Bambusicolous fungi. Fungal Diversity 82:1–105.
https://doi.org/10.1007/s13225-016-0367-8 - Daranagama DA, Camporesi E, Tian Q, Liu XZ, Chamyuang S, Stadler M, Hyde KD. (2015) Anthostomella is polyphyletic comprising several genera in Xylariaceae. Fungal Diversity 73:203–238.
https://doi.org/10.1007/s13225-015-0329-6 - Daranagama DA, Hyde KD, Sir EB, Thambugala KM, Tian Q, Samarakoon MC, McKenzie EHC, Jayasiri SC, Tibpromma S, Bhat DJ, Liu XZ, Stadler M. (2018) Towards a natural classification and backbone tree for Graphostromataceae, Hypoxylaceae, Lopadostomataceae and Xylariaceae. Fungal Diversity 88:1–165.
https://doi.org/10.1007/s13225-017-0388-y - de Hoog GS, Papendorf MC. (1976) The genus Phaeoisaria. Persoonia 8:407–414.
- de Hoog GS, Guarro J, Gené J, Figueras MJ. (2000) Atlas of clinical fungi, 2nd edn. Centraalbureau voor Schimmelcultures, Utrecht, 1126 pp.
- de Hoog GS, Nishikaku AS, Fernandez-Zeppenfeldt G, Padín-González C, Burger E, Badali H, Richard-Yegres N, Gerrits van den Ende AHG. (2007) Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Studies in Mycology 58:219–234.
https://doi.org/10.3114/sim.2007.58.08 - Deighton FC. (1985) Three leaf-spotting hyphomycetes on palms. Transactions of the British Mycological Society 85:739–742.
https://doi.org/10.1016/S0007-1536(85)80275-8 - de Notaris G. (1847) Prime linee di una nuova disposizione dei Pirenomiceti Isterini. Giornale Botanico Italiano 2(7–8):5–52.
- de Silva NI, Thambugala KM, Jeewon R, Phookamsak R, Goonasekara ID, Lumyong S, Hyde KD. (2018) Morphology and phylogeny of Atrocalyx acervatus sp. nov. (Lophiotremataceae) from Acer species. Phytotaxa 333:199–208.
https://doi.org/10.11646/phytotaxa.333.2.3 - de Silva NI, Hyde KD, Lumyong S, Phillips AJL, Bhat DJ, Maharachchikumbura SSN, Thambugala KM, Tennakoon DS, Suwannarach N, Karunarathna SC. (2022a) Morphology, phylogeny, host association and geography of fungi associated with plants of Annonaceae, Apocynaceae and Magnoliaceae. Mycosphere 13(1):955–1076.
https://doi.org/10.5943/mycosphere/13/1/12 - de Silva NI, Thambugala KM, Tennakoon DS, Karunarathna SC, Kumla J, Suwannarach N, Lumyong S. (2022b) Taxonomy and phylogenetic appraisal of Dothideomycetous fungi associated with Magnolia, Lilium longiflorum and Hedychium coronarium. Journal of Fungi 8:1094.
https://doi.org/10.3390/jof8101094 - Dhillon B, Graham F, Laughinghouse HD, Chakrabarti S. (2024) Assessment of endophytic fungal community in palm leaves and their biocontrol potential. PhytoFrontiers 4(3):296–304.
https://doi.org/10.1094/PHYTOFR-04-23-0053-R - Diederich P, Ertz D, Lawrey JD, Sikaroodi M, Untereiner WA. (2013) Molecular data place the hyphomycetous lichenicolous genus Sclerococcum close to Dactylospora (Eurotiomycetes) and S. parmeliae in Cladophialophora (Chaetothyriales). Fungal Diversity 58:61–72.
https://doi.org/10.1007/s13225-012-0179-4 - Diederich P, Lawrey JD, Ertz D. (2018) The 2018 classification and checklist of lichenicolous fungi, with 2000 non-lichenized, obligately lichenicolous taxa. The Bryologist 121:340–425.
https://doi.org/10.1639/0007-2745-121.3.340 - Dighton J, White JF. (2017) The fungal community: its organization and role in the ecosystem. CRC Press, Boca Raton.
https://doi.org/10.1201/9781315119496 - Dissanayake AJ, Bhunjun CS, Maharachchikumbura SSN, Liu JK. (2020) Applied aspects of methods to infer phylogenetic relationships amongst fungi. Mycosphere 11:2652–2676.
https://doi.org/10.5943/mycosphere/11/1/18 - Dissanayake AJ, Phillips AJL, Li XH, Hyde KD. (2016) Botryosphaeriaceae: current status of genera and species. Mycosphere 7:1001–1073.
https://doi.org/10.5943/mycosphere/si/1b/13 - Dissanayake LS, Phookamsak R, Xu J, Wanasinghe DN. (2024b) Oxydothis ailaoshanensis sp. nov. (Oxydothidaceae, Xylariales) from dead bamboo culms in Yunnan Province, China. Studies in Fungi 9:e016.
https://doi.org/10.48130/sif-0024-0016 - Dissanayake LS, Samarakoon MC, Maharachchikumbura SSN, Hyde KD, Tang X, Li QR, Mortimer PE, Faraj TK, Xu JC, Kang JC, Wanasinghe DN. (2024a) Exploring the taxonomy and phylogeny of Sordariomycetes taxa emphasizing Xylariomycetidae in Southwestern China. Mycosphere 15(1):1675–1793.
https://doi.org/10.5943/mycosphere/15/1/15 - Döbbeler P, Buck WR. (2017) Dactylospora inopina (Lecanorales), a new biotrophic parasite on Radula (Hepaticae) from the Cape Horn Archipelago, Chile. Nova Hedwigia 105:87–93.
https://doi.org/10.1127/nova_hedwigia/2017/0403 - Doilom M, Dissanayake AJ, Wanasinghe DN, Boonmee S, Liu JK, Bhat DJ, Taylor JE, Bahkali AH, McKenzie EHC, Hyde KD. (2017) Microfungi on Tectona grandis (teak) in Northern Thailand. Fungal Diversity 82:107–182.
https://doi.org/10.1007/s13225-016-0368-7 - Doilom M, Hyde KD, Phookamsak R, Dai DQ, Tang LZ, Hongsanan S, Chomnunti P, Boonmee S, Dayarathne MC, Li WJ, Thambugala KM, Perera RH, Daranagama DA, Norphanphoun C, Konta S et al. (2018) Mycosphere notes 225–274: types and other specimens of some genera of Ascomycota. Mycosphere 9(4):647–754.
https://doi.org/10.5943/mycosphere/9/4/3 - Dong W, Hyde KD, Bhat DJ, Zhang H. (2018) Introducing Aculeata aquatica gen. et sp. nov., Minimelanolocus thailandensis sp. nov. and Thysanorea aquatica sp. nov. (Herpotrichiellaceae, Chaetothyriales) from freshwater in northern Thailand. Mycological Progress 17:617–629.
https://doi.org/10.1007/s11557-018-1389-2 - Dong W, Hyde KD, Jeewon R, Doilom M, Yu XD, Wang GN, Liu NG, Hu DM, Nalumpang S, Zhang H. (2021a) Towards a natural classification of annulatascaceae-like taxa II: introducing five new genera and eighteen new species from freshwater. Mycosphere 12(1):1–88.
https://doi.org/10.5943/mycosphere/12/1/1 - Dong W, Wang B, Hyde KD, McKenzie EHC, Raja HA, Tanaka K, Abdel-Wahab MA, Abdel-Aziz FA, Doilom M, Phookamsak R, Hongsanan S, Wanasinghe DN, Yu XD, Wang GN, Yang H et al. (2020) Freshwater Dothideomycetes. Fungal Diversity 105:319–575.
https://doi.org/10.1007/s13225-020-00463-5 - Dong W, Zhang H, Doilom M, Yu XD, Wang GN, Nalumpang S. (2021b) Rhexodenticula aquatica (Sordariomycetidae genera incertae sedis), a novel hyphomycete from freshwater in Thailand. Phytotaxa 483:129–138.
https://doi.org/10.11646/phytotaxa.483.2.5 - Du HZ, Chi MF, Wu N, Dissanayake AJ, Liu NG, Cheewangkoon R, Liu JK. (2025a) Taxonomic and phylogenetic insights to Dothideomycetes and Sordariomycetes associated with medicinal plants in Southwestern China. Mycosphere 16(2):179–343.
https://doi.org/10.5943/mycosphere/16/2/2 - Du HZ, Liu NG, Wu N, Cheewangkoon R, Liu JK. (2025b) Morpho-phylogenetic evidence reveals novel hyphomycetous fungi on medicinal plants in Southwestern China. Mycology 1–60.
https://doi.org/10.1080/21501203.2024.2444436 - Ehrenberg CG. (1818) Sylvae mycologicae berolinenses. Formis Theophili Bruschcke, Berlin.
- Ekanayaka AH, Hyde KD, Gentekaki E, McKenzie EHC, Zhao Q, Bulgakov TS, Camporesi E. (2019a) Preliminary classification of Leotiomycetes. Mycosphere 10(1):310–489.
https://doi.org/10.5943/mycosphere/10/1/7 - Ekanayaka AH, Jones EBG, Hyde KD, Zhao Q. (2019b) A stable phylogeny for Dactylosporaceae. Cryptogamie, Mycologie 40:23–44.
https://doi.org/10.5252/cryptogamie-mycologie2019v40a3 - Elliott ML. (2011) First report of Fusarium wilt caused by Fusarium oxysporum f. sp. palmarum on Canary Island date palm in Florida. Plant Disease 95:356.
https://doi.org/10.1094/PDIS-11-10-0851 - Elliott ML, Des Jardin EA. (2014) Serenomyces associated with palms in southeastern USA: isolation, culture storage and genetic variation. Mycologia 106:698–707.
https://doi.org/10.3852/13-353 - Ellis MB. (1957) Haplobasidion, Lacellinopsis and Lacellina. Mycological Papers 67:1–15.
- Ellis MB. (1963) Dematiaceous Hyphomycetes. V. Mycological Papers 93:1–33.
- Ellis MB. (1967) Dematiaceous Hyphomycetes. VIII. Periconiella, Trichodochium, etc. Mycological Papers 111:1–46.
- Ellis MB. (1971) Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, Surrey, England.
https://doi.org/10.1079/9780851986180.0000 - Eriksson OE. (1966) On Anthostomella Sacc., Entosordaria (Sacc.) Hohn. and some related genera (pyrenomycetes). Svensk Botanisk Tidskrift 60:315–324.
- Fan XL, Hyde KD, Liu M, Liang YM, Tian CM. (2015a) Cytospora species associated with walnut canker disease in China, with description of a new species C. gigalocus. Fungal Biology 119(5):310–319.
https://doi.org/10.1016/j.funbio.2014.12.011 - Fan XL, Hyde KD, Yang Q, Liang YM, Ma R, Tian CM. (2015b) Cytospora species associated with canker disease of three anti-desertification plants in northwestern China. Phytotaxa 197(4):227–244.
https://doi.org/10.11646/phytotaxa.197.4.1 - Farr DF, Rossman AY. (2025) Fungal databases, US National Fungus Collections, ARS, USDA.
Available online: https://nt.ars-grin.gov/fungaldatabases/ (accessed on 15 April 2025). - Farr DF, Rossman AY, Castlebury LA. (2021) United States National Fungus Collections Fungus-Host Dataset. Ag Data Commons.
https://doi.org/10.15482/USDA.ADC/1524414 - Fehr V, Buitenwerf R, Svenning JC. (2020) Non-native palms (Arecaceae) as generators of novel ecosystems: a global assessment. Diversity and Distributions 26(11):1523–1538.
https://doi.org/10.1111/ddi.13150 - Feng PY, de Hoog GS, Najafzadeh MJ, Gerrits van den Ende AHG, Stielow JB, Badali H, Boeger WA, Vicente VA. (2014) Cladophialophora abundans, a novel species of Chaetothyriales isolated from the natural environment. Mycological Progress 13:381–391.
https://doi.org/10.1007/s11557-013-0924-4 - Feng Y, Zhang SN, Chen YY, Liu ZY. (2022) Fissuroma bambucicola sp. nov. (Aigialaceae, Pleosporales) from bamboo in Guizhou, China. Phytotaxa 543:64–72.
https://doi.org/10.11646/phytotaxa.543.1.6 - Francis SM. (1975) Anthostomella Sacc. (Part 1). Mycological Papers 139:1–97.
- Fries EM. (1819) Novitiae forae suecicae. Part V. Berling, Lund, Sweden.
- Fries EM. (1825) Systema orbis vegetabilis. Typographia Academia, Lund.
- Fries EM. (1836) Corpus Florarum provincialium suecicae I. Floram Scanicam, 193–346.
https://doi.org/10.5962/bhl.title.47083 - Fröhlich J, Hyde KD. (1999) Biodiversity of palm fungi in the tropics: Are global fungal diversity estimates realistic? Biodiversity and Conservation 8:977–1004.
https://doi.org/10.1023/A:1008895913857 - Fröhlich J, Hyde KD. (2000) Palm microfungi. Fungal Diversity Research Series 3:1–393.
- Fröhlich J, Hyde KD, Petrini O. (2000) Endophytic fungi associated with palms. Mycological Research 104:1202–1212.
https://doi.org/10.1017/S095375620000263X - Gams W, O’Donnell K, Schroers HJ, Christensen M. (1998) Generic classification of some more hyphomycetes with solitary conidia borne on phialides. Canadian Journal of Botany 76:1570–1583.
https://doi.org/10.1139/b98-104 - Gawas P, Bhat DJ. (2005) Vamsapriya indica gen. et sp. nov., a bambusicolous, synnematous fungus from India. Mycotaxon 94:149–154.
- Glass NL, Donaldson GC. (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology 61(4):1323–1330.
https://doi.org/10.1128/aem.61.4.1323-1330.1995 - Goh TK, Hyde KD. (1997) Melanographium palmicolum sp. nov. from Hong Kong, and a key to the genus. Mycological Research 101:1097–1100.
https://doi.org/10.1017/S0953756297003675 - Goh TK, Hyde KD. (1998) A new hyphomycete genus, Conioscyphopsis, from wood submerged in a freshwater stream and a review of Conioscypha. Mycological Research 102:308–312.
https://doi.org/10.1017/S0953756297004942 - Gorelick N, Hancher M, Dixon M, Ilyushchenko S, Thau D, Moore R. (2017) Google Earth Engine: Planetary-scale geospatial analysis for everyone. Remote Sensing of Environment 202:18–27.
https://doi.org/10.1016/j.rse.2017.06.031 - Grossart HP, Van den Wyngaert S, Kagami M, Wurzbacher C, Cunliffe M, Rojas-Jimenez K. (2019) Fungi in aquatic ecosystems. Nature Reviews Microbiology 17(6):339–354.
https://doi.org/10.1038/s41579-019-0175-8 - Grum-Grzhimaylo AA, Georgieva ML, Bondarenko SA, Debets AJM, Bilanenko EN. (2016) On the diversity of fungi from soda soils. Fungal Diversity 76:27–74.
https://doi.org/10.1007/s13225-015-0320-2 - Guarro J, Vieira LA, de Freitas D, Gené J, Zaror L, Hofling-Lima AL, Fischman O, Zorat-Yu C, Figueras MJ. (2000) Phaeoisaria clematidis as a cause of keratomycosis. Journal of Clinical Microbiology 38(6):2434–2437.
https://doi.org/10.1128/JCM.38.6.2434-2437.2000 - Haase G, Sonntag L, Melzer-Krick B, de Hoog GS. (1999) Phylogenetic inference by SSU-gene analysis of members of the Herpotrichiellaceae with special reference to human pathogenic species. Studies in Mycology 43:80–97.
- Hafellner J. (1979) Karschia. Revision einer Sammelgattung an der Grenze von lichenisierten und nichtlichenisierten Ascomyceten. Beihefte zur Nova Hedwigia 62:1–248.
- Haines JH, Dumont KP. (1983) Studies in the Hyaloscyphaceae II: Proliferodiscus, a new genus of Arachnopezizoideae. Mycologia 75:535–543.
https://doi.org/10.1080/00275514.1983.12023717 - Harkness HW. (1884) New species of Californian fungi. Bulletin of the California Academy of Sciences 1:29–47.
- Harrison S, Spasojevic MJ, Li D. (2020) Climate and plant community diversity in space and time. Proceedings of the National Academy of Sciences of the United States of America 117(9):4464–4470.
https://doi.org/10.1073/pnas.1921724117 - Hashimoto A, Matsumura M, Hirayama K, Tanaka K. (2017) Revision of Lophiotremataceae (Pleosporales, Dothideomycetes): Aquasubmersaceae, Cryptocoryneaceae, and Hermatomycetaceae fam. nov. Persoonia - Molecular Phylogeny and Evolution of Fungi 39:51–73.
https://doi.org/10.3767/persoonia.2017.39.03 - Hassan NSM, Hossain MS, Balakrishnan V, Zuknik MH, Mustaner M, Easa AM, Al-Gheethi A, Yahaya ANA. (2021) Influence of fresh palm fruit sterilization in the production of carotenoid-rich virgin palm oil. Foods 10(11):2838.
https://doi.org/10.3390/foods10112838 - Hawksworth DL. (1991) The fungal dimension of biodiversity: magnitude, significance, and conservation. Mycological Research 95(6):641–655.
https://doi.org/10.1016/S0953-7562(09)80810-1 - Hawksworth DL. (2012) Global species numbers of fungi: Are tropical studies and molecular approaches contributing to a more robust estimate? Biodiversity and Conservation 21:2425–2433.
https://doi.org/10.1007/s10531-012-0335-x - Hawksworth DL, Lücking R. (2017) Fungal diversity revisited: 2.2 to 3.8 million species. Microbiology Spectrum 5:17.
https://doi.org/10.1128/microbiolspec.FUNK-0052-2016 - Hennings P. (1902) Fungi blumenaviensis II, a cl. Alfr Möller lecti. Hedwigia 41:1–33.
- Hernández-Hernández J, Espino A, Rodríguez-Rodríguez JM, Pérez-Sierra A, León M, Abad-Campos P, Armengol J. (2010) Survey of diseases caused by Fusarium spp. on palm trees in the Canary Islands. Phytopathologia Mediterranea 49:84–88.
https://doi.org/10.14601/Phytopathol_Mediterr-3094 - Hernández-Restrepo M, Decock CA, Costa MM, Crous PW. (2022) Phylogeny and taxonomy of Circinotrichum, Gyrothrix, Vermiculariopsiella and other setose hyphomycetes. Persoonia - Molecular Phylogeny and Evolution of Fungi 49:99–135.
https://doi.org/10.3767/persoonia.2022.49.03 - Hernández-Restrepo M, Gené J, Castañeda-Ruiz RF, Mena-Portales J, Crous PW, Guarro J. (2017) Phylogeny of saprobic microfungi from Southern Europe. Studies in Mycology 86:53–97.
https://doi.org/10.1016/j.simyco.2017.05.001 - Hernández-Restrepo M, Giraldo A, van Doorn R, Wingfield MJ, Groenewald JZ, Barreto RW, Colmán AA, Mansur PSC, Crous PW. (2020) The Genera of Fungi–G6: Arthrographis, Kramasamuha, Melnikomyces, Thysanorea, and Verruconis. Fungal Systematics and Evolution 6:1–24.
https://doi.org/10.3114/fuse.2020.06.01 - Hilbe JM. (2011) Negative binomial regression. Cambridge University Press.
https://doi.org/10.1017/CBO9780511973420 - Hirayama K, Tanaka K. (2011) Taxonomic revision of Lophiostoma and Lophiotrema based on reevaluation of morphological characters and molecular analyses. Mycoscience 52:401–412.
https://doi.org/10.1007/s10267-011-0114-8 - Ho MHM, Castañeda RF, Dugan FM, Jong SC. (1999) Cladosporium and Cladophialophora in culture: descriptions and an expanded key. Mycotaxon 72:115–157.
- Ho WH, Yanna, Hyde KD, Goh TK. (2005) Endosporoideus gen. nov., a mitosporic fungus on Phoenix hanceana. Mycologia 97:238–245.
https://doi.org/10.3852/mycologia.97.1.238 - Höhnel F von (1904) Mycologische Fragmente. (Fortsetzung) [XLII–LXIX]. Annales Mycologici 2(1): 38–60.
- Höhnel F von (1909) Fragmente zur Mykologie: VI. Mitteilung (Nr. 182 bis 288). Sitzungsberichte der Kaiserlichen Akademie der Wissenschaften in Wien, Mathematisch-Naturwissenschaftliche Klasse, Abteilung I 118: 275–452.
- Höhnel F von (1918) Mycologische Fragmente, 272. Über die Hysteriaceen. Annales Mycologici 16: 145–154.
- Höhnel F von (1923) Studien über Hyphomyzeten. Aus den hinterlassenen Schriften zusammengestellt und herausgegeben von Jos. Weese. Centralblatt für Bakteriologie, Parasitenkunde, Infektionskrankheiten und Hygiene, Abteilung 2 60: 1–26.
- Holm L, Holm K (1988) Studies in the Lophiostomataceae with emphasis on the Swedish species. Acta Univ Ups Symb Bot Ups 28: 1–50.
- Hongsanan S, Hyde KD, Phookamsak R, Wanasinghe DN, McKenzie EHC, Sarma VV, Boonmee S, Lücking R, Bhat DJ, Liu NG, Tennakoon DS, Pem D, Karunarathna A, Jiang SH, Jones EBG et al. (2020a) Refined families of Dothideomycetes: Dothideomycetidae and Pleosporomycetidae. Mycosphere 11:1553–2107.
https://doi.org/10.5943/mycosphere/11/1/13 - Hongsanan S, Hyde KD, Phookamsak R, Wanasinghe DN, McKenzie EHC, Sarma VV, Lücking R, Boonmee S, Bhat DJ, Liu NG, Tennakoon DS, Pem D, Karunarathna A, Jiang SH, Jones EBG et al. (2020b) Refined families of Dothideomycetes: orders and families incertae sedis in Dothideomycetes. Fungal Diversity 105:17–318.
https://doi.org/10.1007/s13225-020-00462-6 - Hosagoudar VB, Mathew S. (2000) A preliminary report on the mycoflora of the Andaman & Nicobar Islands, India. Journal of Economic and Taxonomic Botany 24:631–640.
- Hu YF, Liu JW, Luo XX, Xu ZH, Xia JW, Zhang XG, Castañeda-Ruiz RF, Ma J. (2023) Multilocus phylogenetic analyses reveal eight novel species of Distoseptispora from southern China. Microbiology Spectrum 11:e02468–02423.
https://doi.org/10.1128/spectrum.02468-23 - Hughes SJ. (1951) Studies on micro-fungi. III. Mastigosporium, Camposporium, and Ceratophorum. Mycological Papers 36:1–43.
- Hughes SJ. (1978) New Zealand fungi. 25. Miscellaneous species. New Zealand Journal of Botany 16:311–370.
https://doi.org/10.1080/0028825X.1978.10425143 - Hughes SJ. (1981) New Zealand fungi: 31. Capnobotrys, an anamorph of Metacapnodiaceae. New Zealand Journal of Botany 19:193–226.
https://doi.org/10.1080/0028825X.1981.10425120 - Hyde KD. (1991) A new amphisphaeriaceous fungus from intertidal fronds of Nypa fruticans. Transactions of the Mycological Society of Japan 32:265–271.
- Hyde KD. (1992) Fungi from palms. I. The genus Linocarpon, a revision. Sydowia 44:32–54.
- Hyde KD. (1994) Fungi from palms. XIII. The genus Oxydothis, a revision. Sydowia 46:265–314.
- Hyde KD. (1995) Measuring biodiversity of microfungi in the wet tropics of North Queensland. In: Boyle TJB, Boontawee B (eds) Proceedings of the measuring and monitoring biodiversity of tropical and temperate forests, Chiang Mai, Thailand. CIFOR, Bogor, pp 271–286.
- Hyde KD. (1996) Biodiversity of microfungi in North Queensland. Australian Systematic Botany 9:261–271.
https://doi.org/10.1071/SB9960261 - Hyde KD. (1997) Diversity of Ascomycetes on palms in the tropics. Biodiversity of Tropical Microfungi. Hong Kong University Press, Hong Kong, pp 141–156.
- Hyde KD. (2001) Non-lichenised Australian ascomycetes. Australian Systematic Botany 14:357–375.
https://doi.org/10.1071/SB99036 - Hyde KD, Bao DF, Hongsanan S, Chethana KWT, Yang J, Suwannarach N. (2021) Evolution of freshwater Diaporthomycetidae (Sordariomycetes) provides evidence for five new orders and six new families. Fungal Diversity 107:71–105.
https://doi.org/10.1007/s13225-021-00469-7 - Hyde KD, Cannon PF. (1999) Fungi causing tar spots on palms. Mycological Papers 175:1–114.
- Hyde KD, de Silva NI, Jeewon R, Bhat DJ et al. (2020a) AJOM new records and collections of fungi: 1–100. Asian J Mycol 3(1): 22–294.
- Hyde KD, Dong Y, Phookamsak R, Jeewon R et al. (2020b) Fungal diversity notes 1151–1276: taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Divers 100(1): 5–277.
- Hyde KD, Fröhlich J. (2003) Nigramammilla calami gen. et sp. nov. and Arecomyces calami, A. licualae and Pseudohalonectria palmae spp. nov. from palms. Cryptogamie, Mycologie 24:13–20.
- Hyde KD, Hongsanan S, Jeewon R, Bhat DJ, McKenzie EHC, Jones EBG, Phookamsak R, Ariyawansa HA, Boonmee S, Zhao Q, Abdel-Aziz FA, Abdel-Wahab MA, Banmai S, Chomnunti P, Cui BK et al. (2016) Fungal diversity notes 367–491: taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 80:1–270.
https://doi.org/10.1007/s13225-016-0373-x - Hyde KD, Jeewon R, Chen YJ, Bhunjun CS, Calabon MS, Jiang HB, Lin CG, Norphanphoun C, Sysouphanthong P, Pem D, Tibpromma S, Zhang Q, Doilom M, Jayawardena RS, Liu JK et al. (2020c) The numbers of fungi: is the descriptive curve flattening? Fungal Diversity 103:219–271.
https://doi.org/10.1007/s13225-020-00458-2 - Hyde KD, Jones EBG, Liu JK, Ariyawansa HA et al. (2013) Families of Dothideomycetes. Fungal Divers 63(1):1–313.
- Hyde KD, Noorabadi MT, Thiyagaraja V, He MQ, Johnston PR, Wijesinghe SN, Armand A, Biketova AY, Chethana KWT, Erdoğdu M, Ge ZW, Groenewald JZ, Hongsanan S, Kušan I, Leontyev DV et al. (2024a) The 2024 Outline of Fungi and fungus-like taxa. Mycosphere 15(1):5146–6239.
https://doi.org/10.5943/mycosphere/15/1/25 - Hyde KD, Norphanphoun C, Maharachchikumbura SSN, Bhat DJ, Jones EBG, Bundhun D, Chen YJ, Bao DF, Boonmee S, Calabon MS, Chaiwan N, Chethana KWT, Dai DQ, Dayarathne MC, Devadatha B et al. (2020d) Refined families of Sordariomycetes. Mycosphere 11(1):305–1059.
https://doi.org/10.5943/mycosphere/11/1/7 - Hyde KD, Saleh A, Aumentado HDR, Boekhout T, Bera I, Khyaju S, Bhunjun CS, Chethana KWT, Phukhamsakda C, Doilom M, Thiyagaraja V, Mortimer PE, Maharachchikumbura SSN, Hongsanan S, Jayawardena RS et al. (2024b) Fungal numbers: global needs for a realistic assessment. Fungal Diversity 128(1):191–225.
https://doi.org/10.1007/s13225-024-00545-8 - Hyde KD, Tennakoon DS, Jeewon R, Bhat DJ, Maharachchikumbura SSN, Rossi W, Leonardi M, Lee HB, Mun HY, Houbraken J, et al. (2019) Fungal diversity notes 1036–1150: taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Diversity 96:1–242.
https://doi.org/10.1007/s13225-019-00429-2 - Hyde KD, Wijesinghe SN, Afshari N, Aumentado HD, Bhunjun CS, Boonmee S, Camporesi E, Chethana KWT, Doilom M, Dong W, Du TY, Farias ARG, Gao Y, Jayawardena RS, Karimi O et al. (2024c) Mycosphere Notes 469–520. Mycosphere 15(1):1294–1454.
https://doi.org/10.5943/mycosphere/15/1/11 - Hyde KD, Wijesinghe SN, Amuhenage TB, Bera I, Bhunjun CS, Chethana KWT, de Farias ARG, Dong W, Du TY, Gao Y, Gui H, Gunarathne A, Jayawardena RS, Li H, Liu JK et al. (2024d) Current research in applied and environmental mycology fungal profiles 1–30. Current Research in Environmental & Applied Mycology (Journal of Fungal Biology) 14(1):167–266.
https://doi.org/10.5943/cream/14/1/11 - Ichinoe M. (1971) Camposporium species from Japan. Transactions of the Mycological Society of Japan 12:79–88.
- Ishii T, Nonaka K, Iwatsuki M, Masuma R, Omura S, Shiomi K. (2012) Virgaricin produced by Virgaria sp. FKI-4860. The Journal of Antibiotics 65(3):139–141.
https://doi.org/10.1038/ja.2011.123 - Jackson GVH, McKenzie EHC. (1988) Marasmiellus cocophilus on coconuts in Solomon Islands. FAO Plant Protection Bulletin 36:91–97.
- Jaklitsch WM, Fournier J, Voglmayr H. (2018) Two unusual new species of Pleosporales: Anteaglonium rubescens and Atrocalyx asturiensis. Sydowia 70:129–140.
https://doi.org/10.12905/0380.sydowia70-2018-0129 - Jami F, Marincowitz S, Slippers B, Wingfield MJ. (2018) New botryosphaeriales on native red milkwood (Mimusops caffra). Australasian Plant Pathology 47:475–484.
https://doi.org/10.1007/s13313-018-0586-4 - Jayasiri SC, Hyde KD, Ariyawansa HA, Bhat J, Buyck B, Cai L, Dai YC, Abd-Elsalam KA, Ertz D, Hidayat I, Jeewon R, Jones EBG, Bahkali AH, Karunarathna SC, Liu JK et al. (2015) The Faces of Fungi database: fungal names linked with morphology, phylogeny and human impacts. Fungal Diversity 74:3–18.
https://doi.org/10.1007/s13225-015-0351-8 - Jayasiri SC, Hyde KD, Jeewon R, Bhat DJ, Camporesi E, Kang JC. (2016a) Neooccultibambusa jonesii, a novel taxon within Occultibambusaceae. Mycosphere 7(9):1458–1472.
https://doi.org/10.5943/mycosphere/7/9/17 - Jayasiri SC, Hyde KD, Jones EBG, McKenzie EHC, Jeewon R, Phillips AJL, Bhat DJ, Wanasinghe DN, Liu JK, Lu YZ, Kang JC, Xu J, Karunarathna SC. (2019) Diversity, morphology and molecular phylogeny of Dothideomycetes on decaying wild seed pods and fruits. Mycosphere 10:1–186.
https://doi.org/10.5943/mycosphere/10/1/1 - Jayasiri SC, Hyde KD, Jones EBG, Peršoh D, Camporesi E, Kang JC. (2018) Taxonomic novelties of hysteriform Dothideomycetes. Mycosphere 9(4):803–837.
https://doi.org/10.5943/mycosphere/9/4/8 - Jayasiri SC, Jones EBG, Kang JC, Promputtha I, Bahkali AH, Hyde KD. (2016b) A new species of genus Anteaglonium (Anteagloniaceae, Pleosporales) with its asexual morph. Phytotaxa 263:233–244.
https://doi.org/10.11646/phytotaxa.263.3.4 - Jayawardena RS, Hyde KD, Chethana KWT, Daranagama DA, Dissanayake AJ, Goonasekara ID, Manawasinghe IS, Mapook A, Jayasiri SC, Karunarathne A, Li CG, Phukhamsakda C, Senanayake IC, Wanasinghe DN, Camporesi E et al. (2018) Mycosphere notes 102–168: saprotrophic fungi on Vitis in China, Italy, Russia and Thailand. Mycosphere 9(1):1–114.
https://doi.org/10.5943/mycosphere/9/1/1 - Jayawardena RS, Hyde KD, de Farias ARG, Bhunjun CS, Ferdinandez HS, Manamgoda DS, Udayanga D, Herath IS, Thambugala KM, Manawasinghe IS, Gajanayake AJ, Samarakoon BC, Bundhun D, Gomdola D, Huanraluek N et al. (2021) What is a species in fungal plant pathogens? Fungal Diversity 109:239–266.
https://doi.org/10.1007/s13225-021-00484-8 - Jayawardena RS, Hyde KD, Wang S, Sun YR, Suwannarach N, Sysouphanthong P, Abdel-Wahab MA, Abdel-Aziz FA, Abeywickrama PD, Abreu VP, Armand A, Aptroot A, Bao DF, Begerow D, Bellanger JM et al. (2022) Fungal diversity notes 1512–1610: taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Diversity 117:1–272.
https://doi.org/10.1007/s13225-022-00513-0 - Karimi O, Chethana KWT, de Farias ARG, Asghari R, Kaewchai S, Hyde KD, Li QR. (2024) Morphology and multigene phylogeny reveal three new species of Distoseptispora (Distoseptisporales, Distoseptisporaceae) on palms (Arecaceae) from peat swamp areas in southern Thailand. MycoKeys 102:55.
https://doi.org/10.3897/mycokeys.102.112815 - Kiffer E, Morelet M. (2000) The Deuteromycetes, mitosporic fungi, classification and generic keys. Science Publishers, Enfield.
- Kirk PM. (1982) New or interesting microfungi VI: Sporidesmiella gen. nov. (hyphomycetes). Transactions of the British Mycological Society 79:479–489.
https://doi.org/10.1016/S0007-1536(82)80040-5 - Kirk PM, Cannon PF, Minter DW, Stalpers JA. (2008) Dictionary of the fungi, 10th edn. CABI, Wallingford.
- Kirschner R, Hsieh SY. (2023) Xylolentia simplex, a hyphomycete from dead petioles of the fern Angiopteris lygodiifoliam in Taiwan. Fungal Science 38(1):13–21.
- Klaubauf S, Tharreau D, Fournier E, Groenewald JZ, Crous PW, de Vries RP, Lebrun MH. (2014) Resolving the polyphyletic nature of Pyricularia (Pyriculariaceae). Studies in Mycology 79:85–120.
https://doi.org/10.1016/j.simyco.2014.09.004 - Klotz LJ, Fawcett HS. (1932) Black scorch of the date palm caused by Thielaviopsis paradoxa. Journal of Agricultural Research 44:155–166.
- Kohlmeyer J, Volkmann-Kohlmeyer B, Eriksson OE. (1996) Fungi on Juncus roemerianus. 8: New bitunicate ascomycetes. Canadian Journal of Botany 74:1830–1840.
https://doi.org/10.1139/b96-220 - Konta S, Hongsanan S, Eungwanichayapant PD, Liu JK, Jeewon R, Hyde KD, Maharachchikumbura SSN, Boonmee S. (2017) Leptosporella (Leptosporellaceae fam. nov.) and Linocarpon and Neolinocarpon (Linocarpaceae fam. nov.) are accommodated in Chaetosphaeriales. Mycosphere 8(10):1943–1974.
https://doi.org/10.5943/mycosphere/8/10/16 - Konta S, Hongsanan S, Phillips AJL, Jones EBG, Boonmee S, Hyde KD. (2016a) Botryosphaeriaceae from palms in Thailand II: two new species of Neodeightonia, N. rattanica and N. rattanicola from Calamus (rattan palm). Mycosphere 7(7):950–961.
https://doi.org/10.5943/mycosphere/si/1b/6 - Konta S, Hongsanan S, Tibpromma S, Thongbai B, Maharachchikumbura SSN, Bahkali AH, Hyde KD, Boonmee S. (2016b) An advance in the endophyte story: Oxydothidaceae fam. nov. with six new species of Oxydothis. Mycosphere 7:1425–1446.
https://doi.org/10.5943/mycosphere/7/9/15 - Konta S, Hyde KD, Eungwanichayapant PD, Doilom M, Tennakoon DS, Senwanna C, Boonmee S. (2020) Fissuroma (Aigialaceae, Pleosporales) appears to be hyperdiverse on Arecaceae; evidence from two new species from southern Thailand. Acta Botanica Brasilica 34(2):384–393.
https://doi.org/10.1590/0102-33062020abb0021 - Konta S, Tibpromma S, Karunarathna SC, Samarakoon MC, Steven LS, Mapook A, Boonmee S, Senwanna C, Balasuriya A, Eungwanichayapant PD, Hyde KD. (2023) Morphology and multigene phylogeny reveal ten novel taxa in Ascomycota from terrestrial palm substrates (Arecaceae) in Thailand. Mycosphere 14(1):107–152.
https://doi.org/10.5943/mycosphere/14/1/2 - Koukol O. (2010) Revision of Septonema ochraceum revealed three new species of Venturiaceae and Herpotrichiellaceae. Mycological Progress 9(3):369–378. https://doi.org/10.1007/s11557-009-0645-x
- Koukol O, Delgado G. (2021) Why morphology matters: the negative consequences of hasty descriptions of putative novelties in asexual ascomycetes. IMA Fungus 12:26.
https://doi.org/10.1186/s43008-021-00073-z - Kularathnage ND, Senanayake IC, de Hoog S, Quan Y, Jayawardena RS, Hyde KD, Qi Z. (2025) Systematics and physiology of Cladophialophora matsushimae (Chaetothyriales) associated with ant carton and five new combinations in Cladophialophora and Epibryon. New Zealand Journal of Botany 1–22.
https://doi.org/10.1080/0028825X.2025.2479092 - Kularathnage ND, Wanasinghe DN, Senanayake IC, Yang Y, Manawasinghe IS, Phillips AJL, Hyde KD, Dong W, Song J. (2022) Microfungi associated with ornamental palms: Byssosphaeria phoenicis sp. nov. (Melanommataceae) and Pseudocoleophoma rhapidis sp. nov. (Dictyosporiaceae) from south China. Phytotaxa 568(2):149–169.
https://doi.org/10.11646/phytotaxa.568.2.2 - Kunze G, Schmidt JC. (1817) Mycologische Hefte 1, i–xvi, 1–109.
- Larsson A. (2014) AliView: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 30:3276–3278.
https://doi.org/10.1093/bioinformatics/btu531 - Leuchtmann A. (1985) Kulturversuche mit einigen Arten der Gattung Lophiostoma Ces. & De Not. Sydowia 38:158–170.
- Levis C, Costa FRC, Bongers F, Peña-Claros M, Clement CR, Junqueira AB, Neves EG, Tamanaha EK, Figueiredo FOG, Salomão RP, Castilho CV, Magnusson WE, Phillips OL, Guevara JE, Sabatier D et al. (2017) Persistent effects of pre-Columbian plant domestication on Amazonian forest composition. Science 355(6328):925–931.
https://doi.org/10.1126/science.aal0157 - Li CJY, Chethana KWT, Lu ZY, Zhao Q. (2022) Two novel species of Lachnaceae (Helotiales, Leotiomycetes) from southwestern China. Current Research in Environmental & Applied Mycology (Journal of Fungal Biology) 12(1):333–345.
https://doi.org/10.5943/cream/12/1/20 - Li DW, Schultes NP, Chen JY, Wang YX, Castañeda-Ruiz RF. (2017) Circinotrichum sinense, a new asexual fungus from Hubei, China. Botany 95:1099–1108.
https://doi.org/10.1139/cjb-2017-0132 - Li G, Wu W, Lu L, Chen B, Chen S. (2023a) Characterization of Pseudofusicoccum species from diseased plantation-grown Acacia mangium, Eucalyptus spp., and Pinus massoniana in Southern China. Pathogens 12:574.
https://doi.org/10.3390/pathogens12040574 - Li JM, Cornelissen B, Rep M. (2020) Host-specificity factors in plant pathogenic fungi. Fungal Genetics and Biology 103447.
https://doi.org/10.1016/j.fgb.2020.103447 - Li QR, Habib K, Long SH, Wu YP, Zhang X, Hu HM, Wu QZ, Liu LL, Zhou SX, Shen XC, Kang JC. (2024) Unveiling fungal diversity in China: new species and records within the Xylariaceae family. Mycosphere 15(1):275–364.
https://doi.org/10.5943/mycosphere/15/1/2 - Li WJ, McKenzie EHC, Liu JK, Bhat DJ, Dai DQ, Camporesi E, Tian Q, Maharachchikumbura SSN, Luo ZL, Shang QJ, Zhang JF, Tangthirasunun N, Karunarathna SC, Xu JC, Hyde KD. (2020) Taxonomy and phylogeny of hyaline-spored coelomycetes. Fungal Diversity 100:279–801.
https://doi.org/10.1007/s13225-020-00440-y - Li WL, Liang RR, Dissanayake AJ, Liu JK. (2023b) Botryosphaerialean fungi associated with woody oil plants cultivated in Sichuan Province, China. MycoKeys 97:71–116.
https://doi.org/10.3897/mycokeys.97.103118 - Li WL, Liang RR, Dissanayake AJ, Liu JK. (2023c) Mycosphere notes 413–448: Dothideomycetes associated with woody oil plants in China. Mycosphere 14:1436–1529.
https://doi.org/10.5943/mycosphere/14/1/16 - Liang J, Li G, Zhou S, Zhao M, Cai L. (2019) Myrothecium-like new species from turfgrasses and associated rhizosphere. MycoKeys 51:29.
https://doi.org/10.3897/mycokeys.51.31957 - Liao CF, Yang YH, Dong W, Tangtrakulwanich K, Zhang YX, Khan S, Nadir S, Kandawatte-Wedaralalage TC, Doilom M. (2024) Tetraploa wurfbainiae sp. nov. (Tetraplosphaeriaceae, Pleosporales) isolated from Wurfbainia villosa in Guangdong, China. New Zealand Journal of Botany 62(2–3):303–316.
https://doi.org/10.1080/0028825X.2024.2311964 - Liew ECY, Aptroot A, Hyde KD. (2000) Phylogenetic significance of the pseudoparaphyses in Loculoascomycete taxonomy. Molecular Phylogenetics and Evolution 16:392–402.
https://doi.org/10.1006/mpev.2000.0801 - Lin CG, McKenzie EHC, Bhat DJ, Liu JK, Hyde KD, Lumyong S. (2018) Pseudodactylaria brevis sp. nov. from Thailand confirms the status of Pseudodactylariaceae. Phytotaxa 369:241–250.
https://doi.org/10.11646/phytotaxa.369.4.1 - Lin L, Bai YK, Pan M, Tian CM, Fan XL. (2023) Morphology and molecular analyses reveal three new species of Botryosphaeriales isolated from diseased plant branches in China. MycoKeys 97:1–19.
https://doi.org/10.3897/mycokeys.97.102653 - Lin L, Fan XL, Groenewald JZ, Jami F, Wingfield MJ, Voglmayr H, Jaklitsch W, Castlebury LA, Tian CM, Crous PW. (2024) Cytospora: an important genus of canker pathogens. Studies in Mycology 109:323–401.
https://doi.org/10.3114/sim.2024.109.05 - Link HF. (1809) Observationes in ordines plantarum naturales. Dissertatio prima complectens Anandrarum ordines Epiphytas, Mucedines, Gastromycos et Fungos. Magazin der Gesellschaft Naturforschender Freunde Berlin 3(1):3–42.
- Liu F, Hu DM, Cai L. (2012) Conlarium duplumascospora gen. et sp. nov. and Jobellisia guangdongensis sp. nov. from freshwater habitats in China. Mycologia 104:1178–1186.
https://doi.org/10.3852/11-379 - Liu JK, Chomnunti P, Cai L, Phookamsak R, Chukeatirote E, Jones EBG, Moslem M, Hyde KD. (2010) Phylogeny and morphology of Neodeightonia palmicola sp. nov. from palms. Sydowia 62:261–276.
- Liu JK, Hyde KD, Jones EBG, Ariyawansa HA, Bhat DJ, Boonmee S, Maharachchikumbura SSN, McKenzie EHC, Phookamsak R, Phukhamsakda C, Shenoy BD, Abdel-Wahab MA, Buyck B, Chen J, Chethana KWT et al. (2015) Fungal diversity notes 1–110: taxonomic and phylogenetic contributions to fungal species. Fungal Diversity 72:1–197.
https://doi.org/10.1007/s13225-015-0324-y - Liu JK, Hyde KD, Jeewon R, Phillips AJL, Maharachchikumbura SSN, Ryberg M, Liu ZY, Zhao Q. (2017) Ranking higher taxa using divergence times: a case study in Dothideomycetes. Fungal Diversity 84:75–99.
https://doi.org/10.1007/s13225-017-0385-1 - Liu JK, Phookamsak R, Doilom M, Wikee S, Li YM, Ariyawansha H, Boonmee S, Chomnunti P, Dai DQ, Bhat DJ, Romero AI, Zhuang WY, Monkai J, Jones EBG, Chukeatirote E et al. (2012) Towards a natural classification of Botryosphaeriales. Fungal Diversity 57:149–210.
https://doi.org/10.1007/s13225-012-0207-4 - Liu JK, Phookamsak R, Jones EBG, Zhang Y, Ko-Ko TW, Hu HL, Boonmee S, Doilom M, Chukeatirote E, Bahkali AH, Wang Y, Hyde KD. (2011) Astrosphaeriella is polyphyletic, with species in Fissuroma gen. nov. and Neoastrosphaeriella gen. nov. Fungal Diversity 51(1):135–154.
https://doi.org/10.1007/s13225-011-0142-9 - Liu LL, Yang J, Liu NG, Chen YY, Gui XX, Liu ZY. (2019a) Sporidesmium guizhouense sp. nov. (Sordariomycetes incertae sedis), a new species from a freshwater habitat in Guizhou Province, China. Phytotaxa 422(2):144–156.
https://doi.org/10.11646/phytotaxa.422.2.2 - Liu NG, Hyde KD, Bhat DJ, Jumpathong J, Liu JK. (2019b) Morphological and phylogenetic studies of Pleopunctum gen. nov. (Phaeoseptaceae, Pleosporales) from China. Mycosphere 10(1):757–775.
https://doi.org/10.5943/mycosphere/10/1/17 - Liu NG, Hyde KD, Sun YR, Bhat DJ, Jones EBG, Jumpathong J, Lin CG, Lu YZ, Yang J, Liu LL, Liu ZY, Liu JK. (2024a) Notes, outline, taxonomy and phylogeny of brown-spored hyphomycetes. Fungal Diversity 129:1–281.
https://doi.org/10.1007/s13225-024-00539-6 - Liu S, García-Palacios P, Tedersoo L, Guirado E, van der Heijden MGA, Wagg C, Chen D, Wang Q, Wang J, Singh BK, Delgado-Baquerizo M. (2022) Phylotype diversity within soil fungal functional groups drives ecosystem stability. Nature Ecology & Evolution 6(7):900–909.
https://doi.org/10.1038/s41559-022-01756-5 - Liu SL, Wang XW, Li GJ, Deng CY, Rossi W, Leonardi M, Liimatainen K, Kekki T, Niskanen T, Smith ME, Ammirati J, Bojantchev D, Abdel-Wahab MA, Zhang M, Tian E et al. (2024b) Fungal diversity notes 1717–1817: taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Diversity 124(1):1–216.
https://doi.org/10.1007/s13225-023-00529-0 - Lombard L, Houbraken J, Decock C, Samson RA, Meijer M, Réblová M, Groenewald JZ, Crous PW. (2016) Generic hyper-diversity in Stachybotriaceae. Persoonia: Molecular Phylogeny and Evolution of Fungi 36(1):156–246.
https://doi.org/10.3767/003158516X691582 - Lord D, Park BJ, Model PG. (2012) Negative binomial regression models and estimation methods. Probability density and likelihood functions. Texas A&M University, Korea Transport Institute, 1–15.
- Lu BS, Hyde KD. (2000) A world monograph of Anthostomella. Fungal Diversity Research Series 4:1–376.
- Lu BS, Hyde KD, Liew ECY. (2000) Eight new species of Anthostomella from South Africa. Mycological Research 104:742–754.
https://doi.org/10.1017/S095375629900177X - Lu L, Karunarathna SC, Liu Y, Elgorban AM, Tibpromma S, Jayawardena RS. (2024) Pseudoconiocessia xishuangbannaensis gen. et sp. nov. in Coniocessiaceae, Xylariales from Coffea liberica in China. Phytotaxa 641(2):125–137.
https://doi.org/10.11646/phytotaxa.641.2.4 - Lu L, Karunarathna SC, Xiong YR, Han LS, Chen XM, Xu RF, Liu XF, Zeng XY, Dai DQ, Elgorban AM, Jayawardena RS, Hyde KD, Tibpromma S. (2025) Taxonomy and systematics of micro-fungi associated with Coffea in southern China and northern Thailand. Fungal Diversity 135:469–743.
https://doi.org/10.1007/s13225-025-00566-x - Luo L, Chethana KWT, Zhao Q, Thiyagaraja V, Al-Otibi F, Hyde KD. (2025) Unveiling fungal diversity: a novel species of Proliferodiscus (Lachnaceae, Helotiales) discovered in China. Phytotaxa 682(3):227–239.
https://doi.org/10.11646/phytotaxa.682.3.3 - Luo ZL, Hyde KD, Bhat DJ, Jeewon R, Maharachchikumbura SSN, Bao DF, Li WL, Su XJ, Yang XY, Su HY. (2018) Morphological and molecular taxonomy of novel species Pleurotheciaceae from freshwater habitats in Yunnan, China. Mycological Progress 17:511–530.
https://doi.org/10.1007/s11557-018-1377-6 - Luo ZL, Hyde KD, Liu JK, Maharachchikumbura SSN, Jeewon R, Bao DF, Bhat DJ, Lin CG, Li WL, Yang J, Liu NG, Lu YZ, Jayawardena RS, Li JF, Su HY. (2019) Freshwater Sordariomycetes. Fungal Diversity 99:451–660.
https://doi.org/10.1007/s13225-019-00438-1 - Ma J, Hyde KD, Tibpromma S, Gomdola D, Liu NG, Norphanphoun C, Bao DF, Boonmee S, Xiao XJ, Zhang LJ, Luo ZL, Zhao Q, Suwannarach N, Karunarathna SC, Liu JK et al. (2024) Taxonomy and systematics of lignicolous helicosporous hyphomycetes. Fungal Diversity 129(1):365–653.
https://doi.org/10.1007/s13225-024-00544-9 - Mack JN, Sproule A, Shields SW, Seifert KA, Smith M, Overy DP. (2024) Two novel Pleosporales species isolated from the bark of Acer saccharum. Fungal Systematics and Evolution 13:1–14.
https://doi.org/10.3114/fuse.2024.13.01 - Maharachchikumbura SSN, Chen YP, Ariyawansa HA, Hyde KD, Haelewaters D, Perera RH, Samarakoon MC, Wanasinghe DN, Bustamante DE, Liu JK, Lawrence DP, Cheewangkoon R, Stadler M. (2021) Integrative approaches for species delimitation in Ascomycota. Fungal Diversity 109:155–179.
https://doi.org/10.1007/s13225-021-00486-6 - Mahmoud FM, Krimi Z, Maciá-Vicente JG, Errahmani MB, Lopez-Llorca LV. (2017) Endophytic fungi associated with roots of date palm (Phoenix dactylifera) in coastal dunes. Revista Iberoamericana de Micología 34:116–120.
https://doi.org/10.1016/j.riam.2016.06.007 - Manawasinghe IS, Calabon MS, Jones EBG, Zhang YX, Liao CF, Xiong YR, Chaiwan N, Kularathnage ND, Liu NG, Tang SM, Sysouphanthong P, Du TY, Luo M, Pasouvang P, Pem D et al. (2022) Mycosphere notes 345–386. Mycosphere 13(1):454–557.
https://doi.org/10.5943/mycosphere/13/1/3 - Manawasinghe IS, Hyde KD, Wanasinghe DN, Karunarathna SC, Maharachchikumbura SSN, Samarakoon MC, Voglmayr H, Pang KL, Chiang MWL, Jones EBG, Saxena RK, Kumar A, Rajeshkumar KC, Selbmann L, Coleine C et al. (2024) Fungal diversity notes 1818–1918: taxonomic and phylogenetic contributions on genera and species of fungi. Fungal Diversity 130(1):1–261.
https://doi.org/10.1007/s13225-024-00541-y - Manawasinghe IS, Phillips AJL, Xu J, Balasuriya A, Hyde KD, Stępień Ł, Harischandra DL, Karunarathna A, Yan J, Weerasinghe J, Luo M, Dong ZY, Cheewangkoon R. (2021) Defining a species in fungal plant pathology: beyond the species level. Fungal Diversity 109:267–282.
https://doi.org/10.1007/s13225-021-00481-x - Mao YX, Lu YT, Hu ZJ, Zhao Y. (2020) Genetic diversity of Trachycarpus fortune (Hook.) H. Wendl germplasm resources in Guizhou by SRAP molecular markers analysis. Journal of Southern Agriculture 51:27–35.
- Marasinghe DS, Hongsanan S, Wanasinghe DN, Boonmee S, Lumyong S, Hyde KD, Ning X. (2022) Morpho-molecular characterization of Brunneofissuraceae fam. nov., Cirsosia mangiferae sp. nov., and Asterina neomangiferae nom. nov. Mycological Progress 21:279–295.
https://doi.org/10.1007/s11557-021-01767-9 - Markovskaja S, Treigiené A. (2007) A new and a rare species of Cryptadelphia and their Brachysporium anamorphs. Nova Hedwigia 84(3–4):495–501.
https://doi.org/10.1127/0029-5035/2007/0084-0495 - Massey FJ Jr. (1951) The Kolmogorov-Smirnov test for goodness of fit. Journal of the American Statistical Association 46(253):68–78.
https://doi.org/10.1080/01621459.1951.10500769 - Matsushima T. (1971) Microfungi of the Solomon Islands and Papua-New Guinea. Kobe, Japan, 1–78.
- Matsushima T. (1975) Icones microfungorum a Matsushima lectorum 163. Kobe, Japan.
- Mauri M, Elli T, Caviglia G, Uboldi G, Azzi M. (2017) RAWGraphs: A visualisation platform to create open outputs. In: Proceedings of the 12th Biannual Conference on Italian SIGCHI Chapter, 28:1–28:5. New York, NY, USA: ACM.
https://doi.org/10.1145/3125571.3125585 - McKenzie EHC, Buchanan PK, Johnston PR. (2004) Checklist of fungi on nikau palm (Rhopalostylis sapida and R. bauerivar. cheesemanii) in New Zealand. New Zealand Journal of Botany 42:335–355.
https://doi.org/10.1080/0028825X.2004.9512908 - Mehl JWM, Slippers B, Roux J, Wingfield MJ. (2011) Botryosphaeriaceae associated with Pterocarpus angolensis (kiaat) in South Africa. Mycologia 103:534–553.
https://doi.org/10.3852/10-003 - Mel’nik VA. (2012) Phaeoisaria vietnamensis sp. nov. and P. clematidis (hyphomycetes) from Vietnam. Mycosphere 3(6):957–960.
https://doi.org/10.5943/mycosphere/3/6/10 - Mendes JCR, Portilho AJS, Aguiar-Dias ACA, Sampaio KLS, Farias LN. (2019) Arecaceae: Uma estratégia diferenciada para o ensino de botânica em uma escola de ensino médio na Ilha de Cotijuba, Pará, Brasil. Enciclopédia Biosfera 16(29):2226–2240.
https://doi.org/10.18677/EnciBio_2019A170 - Miadlikowska J, Kauff F, Högnabba F, Oliver JC, Molnár K, Fraker E, Gaya E, Hafellner J, Hofstetter V, Gueidan C, Otálora MAG, Hodkinson B, Kukwa M, Lücking R, Björk C et al. (2014) A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families. Molecular Phylogenetics and Evolution 79:132–168.
https://doi.org/10.1016/j.ympev.2014.04.003 - Minnis AM, Kennedy AH, Grenier DB, Palm ME, Rossman AY. (2012) Phylogeny and taxonomic revision of the Planistromellaceae including its coelomycetous anamorphs: contributions towards a monograph of the genus Kellermania. Persoonia: Molecular Phylogeny and Evolution of Fungi 29:11–28.
https://doi.org/10.3767/003158512X658766 - Mohammadi AC, Amini Y. (2015) Molecular characterization and identification of Acrostalagmus luteoalbus from saffron in Iran. Agricultural Science Development 4:16–18.
- Monteiro JS, Sotão HMP, Ferreira MCS, Rodrigues FJ, Xavier WKS, Li DW, Castañeda-Ruiz RF. (2022) Vesiculophora diversiseptata gen. & sp. nov. and Anapleurothecium clavatum & Podosporium simile spp. nov. from the Brazilian Amazon. Mycotaxon 137(2):227–237.
https://doi.org/10.5248/137.227 - Mooney CZ. (1997) Monte Carlo simulation. No. 116. Sage.
- Mortimer PE, Jeewon R, Xu JC, Lumyong S, Wanasinghe DN. (2021) Morpho-phylo taxonomy of novel dothideomycetous fungi associated with dead woody twigs in Yunnan Province, China. Frontiers in Microbiology 12:654683.
https://doi.org/10.3389/fmicb.2021.654683 - Mugambi GK, Huhndorf SM. (2009) Parallel evolution of hysterothecial ascomata in ascolocularous fungi (Ascomycota, Fungi). Systematics and Biodiversity 7:453–464.
https://doi.org/10.1017/S147720000999020X - Muscarella R, Emilio T, Phillips OL, Lewis SL, Slik F, Baker WJ, Couvreur TLP, Eiserhardt WL, Svenning JC, Affum-Baffoe K, Aiba SI, de Almeida EC, de Almeida SS, de Oliveira EA, Álvarez-Dávila E et al. (2020) The global abundance of tree palms. Global Ecology and Biogeography 29(9):1495–1514.
https://doi.org/10.1111/geb.13123 - Nees von Esenbeck CDG. (1816) System der Pilze und Schwämme. 1–329.
- Nees von Esenbeck CDG. (1817) Das System der Pilze und Schwämme. Stahelsche Buchhandlung, Würzburg, 371, 18.
https://doi.org/10.5962/bhl.title.110007 - Nguyen TTT, Lee SH, Jeon SJ, Lee HB. (2019) First records of rare ascomycete fungi, Acrostalagmus luteoalbus, Bartalinia robillardoides, and Collariella carteri from freshwater samples in Korea. Mycobiology 47(1):1–11.
https://doi.org/10.1080/12298093.2018.1550894 - Niranjan M, Sarma VV. (2018) New ascomycetous fungi in the family Aigialaceae from Andaman Islands, India. Current Research in Environmental & Applied Mycology (Journal of Fungal Biology) 8(3):351–359.
https://doi.org/10.5943/cream/8/3/6 - Niranjan M, Sarma VV. (2019) New species and new records of Melanommataceae (Pleosporales) from Andaman Islands. Kavaka 52:103–108.
- Nisa H, Kamili AN, Nawchoo IA, Shafi S, Shameem N, Bandh SA. (2015) Fungal endophytes as prolific source of phytochemicals and other bioactive natural products: a review. Microbial Pathogenesis 82:50–59.
https://doi.org/10.1016/j.micpath.2015.04.001 - Nonaka K, Ishii T, Shiomi K, Ōmura S, Masuma R. (2013) Virgaria boninensis, a new hyphomycete (Xylariaceae) from soils in the Bonin Islands, Japan. Mycoscience 54(5):394–399.
https://doi.org/10.1016/j.myc.2013.01.004 - Nylander JAA. (2004) MrModeltest v2. Program distributed by the author, Evolutionary Biology Centre, Uppsala University, Uppsala.
- O'Donnell K, Sarver BAJ, Brandt M, Chang DC, Noble-Wang J, Park BJ, Sutton DA, Benjamin L, Lindsley M, Padhye A, Geiser DM, Ward TJ. (2007) Phylogenetic diversity and microsphere array-based genotyping of human pathogenic Fusaria, including isolates from the multistate contact lens-associated US keratitis outbreaks of 2005 and 2006. Journal of Clinical Microbiology 45(7):2235–2248.
https://doi.org/10.1128/JCM.00533-07 - Outamamat E, Bourhia M, Dounas H, Salamatullah AM, Alzahrani A, Alyahya HK, Albadr NA, Al Feddy MN, Mnasri B, Ouahmane L. (2021) Application of native or exotic arbuscular mycorrhizal fungi complexes and monospecific isolates from saline semi-arid Mediterranean ecosystems improved Phoenix dactylifera's growth and mitigated salt stress negative effects. Plants 10(11):2501.
https://doi.org/10.3390/plants10112501 - Papendorf MC. (1976) Notes on Veronaea including V. compacta sp. nov. Bothalia 12:119–121.
https://doi.org/10.4102/abc.v12i1.1384 - Penzig AJO, Saccardo PA. (1897) Diagnoses Fungorum Novorum in Insula Java Collectorum. Tipografia di Angelo Ciminago, Genova, Italy, Series Secunda 11:491–530.
https://doi.org/10.5962/bhl.title.4921 - Pereira DS, Phillips AJL. (2020) A new leaf spot disease of Chamaerops humilis caused by Palmeiromyces chamaeropicola gen. et sp. nov. Phytopathologia Mediterranea 59:353–363.
https://doi.org/10.14601/Phyto-11213 - Pereira DS, Phillips AJL. (2023a) Palm fungi and their key role in biodiversity surveys: a review. Journal of Fungi 9:1121.
https://doi.org/10.3390/jof9111121 - Pereira DS, Phillips AJL. (2023b) Botryosphaeriaceae on palms—a new species of Neodeightonia, N. chamaeropicola, and new records from diseased foliage of ornamental palms in Portugal. Phytotaxa 627:1–64.
https://doi.org/10.11646/phytotaxa.627.1.1 - Phillips AJL, Alves A, Abdollahzadeh J, Slippers B, Wingfield MJ, Groenewald JZ, Crous PW. (2013) The Botryosphaeriaceae: genera and species known from culture. Studies in Mycology 76:51–167.
https://doi.org/10.3114/sim0021 - Phillips AJL, Alves A, Correia A, Luque J. (2005) Two new species of Botryosphaeria with brown, 1-septate ascospores and Dothiorella anamorphs. Mycologia 97:513–529.
https://doi.org/10.1080/15572536.2006.11832826 - Phillips AJL, Alves A, Pennycook SR, Johnston PR, Ramaley A, Akulov A, Crous PW. (2008) Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the Botryosphaeriaceae. Persoonia: Molecular Phylogeny and Evolution of Fungi 21:29–55.
https://doi.org/10.3767/003158508X340742 - Phillips AJL, Hyde KD, Alves A, Liu JK. (2019) Families in Botryosphaeriales: a phylogenetic, morphological and evolutionary perspective. Fungal Diversity 94:1–22.
https://doi.org/10.1007/s13225-018-0416-6 - Phookamsak R, Hyde KD, Jeewon R, Bhat DJ, Jones EBG, Maharachchikumbura SSN, Raspé O, Karunarathna SC, Wanasinghe DN, Hongsanan S, Doilom M, Tennakoon DS, Machado AR, Firmino AL, Ghosh A et al. (2019) Fungal diversity notes 929–1035: taxonomic and phylogenetic contributions on genera and species of fungi. Fungal Diversity 95:1–273.
https://doi.org/10.1007/s13225-019-00421-w - Phookamsak R, Norphanphoun C, Tanaka K, Dai DQ, Luo ZL, Liu JK, Su HY, Bhat DJ, Bahkali AH, Mortimer PE, Xu JC, Hyde KD. (2015) Towards a natural classification of Astrosphaeriella-like species; introducing Astrosphaeriellaceae and Pseudoastrosphaeriellaceae fam. nov. and Astrosphaeriellopsis, gen. nov. Fungal Diversity 74:143–197.
https://doi.org/10.1007/s13225-015-0352-7 - Phukhamsakda C, McKenzie EHC, Phillips AJL, Jones EBG, Bhat DJ, Stadler M, Bhunjun CS, Wanasinghe DN, Thongbai B, Camporesi E, Ertz D, Jayawardena RS, Perera RH, Ekanayake AH, Tibpromma S et al. (2020) Microfungi associated with Clematis (Ranunculaceae) with an integrated approach to delimiting species boundaries. Fungal Diversity 102:1–203.
https://doi.org/10.1007/s13225-020-00448-4 - Phukhamsakda C, Nilsson RH, Bhunjun CS, De Farias ARG, Sun YR, Wijesinghe SN, Raza M, Bao DF, Lu L, Tibpromma S, Dong W, Tennakoon DS, Tian XG, Xiong YR, Karunarathna SC et al. (2022) The numbers of fungi: contributions from traditional taxonomic studies and challenges of metabarcoding. Fungal Diversity 114:327–386.
https://doi.org/10.1007/s13225-022-00502-3 - Pinnoi A, Lumyong S, Hyde KD, Jones EBG. (2006) Biodiversity of fungi on the palm Eleiodoxa conferta in Sirindhorn peat swamp forest, Narathiwat, Thailand. Fungal Diversity 22:205–218.
- Pinnoi A, Phongpaichit P, Jeewon R, Tang AMC, Hyde KD, Jones EBG. (2010) Phylogenetic relationships of Astrocystis eleiodoxae sp. nov. (Xylariaceae). Mycosphere 1:1–9.
- Pinruan U, Rungjindamai N, Choeyklin R, Lumyong S, Hyde KD, Jones EBG. (2010a) Occurrence and diversity of basidiomycetous endophytes from the oil palm, Elaeis guineensis in Thailand. Fungal Diversity 41:71–88.
https://doi.org/10.1007/s13225-010-0029-1 - Pinruan U, Rungjindamai N, Sakayaroj J, Lumyong S, Hyde KD, Jones EBG. (2010b) Baipadisphaeria gen. nov., a freshwater ascomycete (Hypocreales, Sordariomycetes) from decaying palm leaves in Thailand. Mycosphere 1:53–63.
- Pinruan U, Sakayaroj J, Jones EBG, Hyde KD. (2004) Flammispora gen. nov., a new freshwater ascomycete from decaying palm leaves. Studies in Mycology 50:381–386.
- Pirozynski KA. (1972) Microfungi of Tanzania. I. Miscellaneous fungi on oil palm. II. New hyphomycetes. Mycological Papers 129:1–64.
- Prabhugaonkar A, Bhat DJ. (2009) Rattania setulifera, an undescribed endophytic hyphomycete on rattans from western Ghats, India. Mycotaxon 108:217–222.
https://doi.org/10.5248/108.217 - Prasher IB, Verma RK. (2016) Hyphomycetes diversity of Himachal Pradesh-I. Journal on New Biological Reports 5(1):52–58.
- Punithalingam E. (1969) Studies on Sphaeropsidales in culture. Commonwealth Mycological Institute.
- Rambaut A. (2014) FigTree v1.4.2, a graphical viewer of phylogenetic trees.
- Rambelli A. (2011) Some dematiaceous hyphomycetes from Mediterranean maquis litters. Flora Mediterranea 21:5–204.
- Rannala B, Yang Z. (1996) Probability distribution of molecular evolutionary trees: a new method of phylogenetic inference. Journal of Molecular Evolution 43:304–311.
https://doi.org/10.1007/BF02338839 - Rathna V, Prasanna SL, Anandakumar J, Swathi B, Patil SS, Kujur RS. (2025) Forest alchemists: microbe-mediated nutrient recycling. In: Tree Biology and Biotechnology. Springer Nature Singapore, Singapore:67–86.
https://doi.org/10.1007/978-981-96-0002-1_5 - Rathnayaka AR, Dayarathne MC, Maharachchikumbura SSN, Liu JK, Tennakoon DS, Hyde KD. (2019) Introducing Seriascoma yunnanense sp. nov. (Occultibambusaceae, Pleosporales) based on evidence from morphology and phylogeny. Asian Journal of Mycology 2(1):245–253.
https://doi.org/10.5943/ajom/2/1/15 - Réblová M, Hernández-Restrepo M, Sklenář F, Nekvindová J, Réblová K, Kolařík M. (2022) Consolidation of Chloridium: new classification into eight sections with 37 species and reinstatement of the genera Gongromeriza and Psilobotrys. Studies in Mycology 103(1):87–212.
https://doi.org/10.3114/sim.2022.103.04 - Réblová M, Kolařík M, Nekvindová J, Réblová K, Sklenář F, Miller AN, Hernández-Restrepo M. (2021) Phylogenetic reassessment, taxonomy, and biogeography of Codinaea and similar fungi. Journal of Fungi 7(12):1097.
https://doi.org/10.3390/jof7121097 - Réblová M, Nekvindová J, Bauchová L, Hernández-Restrepo M. (2025) Pleurophragmium parvisporum (Ascomycota): one name, seven stories – a case highlighting the need for verification of strains from public culture collections. IMA Fungus 16.
https://doi.org/10.3897/imafungus.16.173033 - Réblová M, Seifert KA, Fournier J, Štěpánek V. (2016) Newly recognised lineages of perithecial ascomycetes: the new orders Conioscyphales and Pleurotheciales. Persoonia: Molecular Phylogeny and Evolution of Fungi 37(1):57–81.
https://doi.org/10.3767/003158516X689819 - Réblová M, Štěpánek V. (2018) Introducing the Rhamphoriaceae, fam. nov. (Sordariomycetes), two new genera, and new life histories for taxa with Phaeoisaria- and Idriella-like anamorphs. Mycologia 110:750–770.
https://doi.org/10.1080/00275514.2018.1475164 - Rehm H. (1914) Ascomycetes Philippinensis, VI. Leaflets of Philippine Botany 6:2257–2281.
- Reichgelt T, West CK, Greenwood DR. (2018) The relation between global palm distribution and climate. Scientific Reports 8(1):4721.
https://doi.org/10.1038/s41598-018-23147-2 - Ren GC, Tibpromma S, Dong KX, Gao CX, Zhang CS, Karunarathna SC, Elgorban AM, Gui H. (2024) Unveiling fungi associated with Castanopsis woody litter in Yunnan Province, China: Insights into Pleosporales (Dothideomycetes) species. MycoKeys 108:15–45.
https://doi.org/10.3897/mycokeys.108.127560 - Rodrigues KF. (1994) The foliar fungal endophytes of the Amazonian palm Euterpe oleracea. Mycologia 86:376–385.
https://doi.org/10.1080/00275514.1994.12026423 - Rodrigues KF, Samuels GJ. (1990) Preliminary study of endophytic fungi in a tropical palm. Mycological Research 94:827–830.
https://doi.org/10.1016/S0953-7562(09)81386-5 - Rojas NL, Voget CE, Hours RA, Cavalitto SF. (2011) Purification and characterization of a novel alkaline α-L-rhamnosidase produced by Acrostalagmus luteoalbus. Journal of Industrial Microbiology & Biotechnology 38:1515–1522.
https://doi.org/10.1007/s10295-010-0938-8 - Rossman AY, Adams GC, Cannon PF, Castlebury LA, Crous PW, Gryzenhout M, Jaklitsch WM, Mejia LC, Stoykov D, Udayanga D, Voglmayr H, Walker DM. (2015) Recommendations of generic names in Diaporthales competing for protection or use. IMA Fungus 6:145–154.
https://doi.org/10.5598/imafungus.2015.06.01.09 - Rungjindamai N, Pinruan U, Choeyklin R, Hattori T, Jones EBG. (2008) Molecular characterization of basidiomycetous endophytes isolated from leaves, rachis and petioles of the oil palm, Elaeis guineensis, in Thailand. Fungal Diversity 33:139–161.
- Saccardo PA. (1875) Conspectus generum Pyrenomycetum italicorum. Atti della Società Veneto-Trentina di Scienze Naturali in Padova 4:101–141.
- Saccardo PA. (1880) Conspectus generum fungorum Italiae inferiorum nempe ad Sphaeropsideas, Melanconieas et Hyphomyceteas pertinentium, systemate sporologico dispositu. Michelia 2:1–38.
- Saccardo PA. (1913) Notae mycologicae. Series XVII. Annales Mycologici 11(6):546–568.
- Saccardo PA, Paoletti G. (1888) Mycetes Malacenses. Funghi della penisola di Malacca raccolti nel 1885 dell. Ab Benedetto Scortechini. Atti del Reale Istituto Veneto di Scienze, Lettere ed Arti, Serie 6 6:387–428.
- Samarakoon MC, Hyde KD, Maharachchikumbura SSN, Stadler M, Jones EBG, Promputtha I, Suwannarach N, Camporesi E, Bulgakov TS, Liu JK. (2022) Taxonomy, phylogeny, molecular dating and ancestral state reconstruction of Xylariomycetidae (Sordariomycetes). Fungal Diversity 112:1–88.
https://doi.org/10.1007/s13225-021-00495-5 - Schuessler JA, von Blanckenburg F, Bouchez J, Uhlig D, Hewawasam T. (2018) Nutrient cycling in a tropical montane rainforest under a supply-limited weathering regime traced by elemental mass balances and Mg stable isotopes. Chemical Geology 497:74–87.
https://doi.org/10.1016/j.chemgeo.2018.08.024 - Schweinitz LD von. (1832) Synopsis fungorum in America boreali media degentium. Transactions of the American Philosophical Society 4:141–316.
- Seifert KA, Morgan-Jones G, Gams W, Kendrick B. (2011) The genera of hyphomycetes. CBS Biodiversity Series 9. CBS-KNAW Fungal Biodiversity Centre, Utrecht, 997 pp.
- Senanayake IC, Rathnayaka AR, Marasinghe DS, Calabon MS, Gentekaki E, Lee HB, Hurdeal VG, Pem D, Dissanayake LS, Wijesinghe SN, Bundhun D, Nguyen TT, Goonasekara ID, Abeywickrama PD, Bhunjun CS et al. (2020) Morphological approaches in studying fungi: collection, examination, isolation, sporulation and preservation. Mycosphere 11(1):2678–2754.
https://doi.org/10.5943/mycosphere/11/1/20 - Senanayake IC, Rossi W, Leonardi M, Weir A, McHugh M, Rajeshkumar KC, Verma RK, Karunarathna SC, Tibpromma S, Ashtekar N, Ashtamoorthy SK, Raveendran S, Kour G, Singh A, De la Peña-Lastra S et al. (2023) Fungal diversity notes 1611–1716: taxonomic and phylogenetic contributions on fungal genera and species emphasis in south China. Fungal Diversity 122(1):161–403.
https://doi.org/10.1007/s13225-023-00523-6 - Senwanna C, Hongsanan S, Hyde KD, Cheewangkoon R. (2020) First report of the sexual morph of Pseudofusicoccum adansoniae Pavlic, TI Burgess & MJ Wingf. on Para rubber. Cryptogamie, Mycologie 41:133–146.
https://doi.org/10.5252/cryptogamie-mycologie2020v41a7 - Shao YY, Baral HO, Ou XY, Wu H, Huang FC, Zheng HF, Liu B. (2018) New species and records of orbiliaceous fungi from Georgia, USA. Mycological Progress 17:1225–1235.
https://doi.org/10.1007/s11557-018-1438-x - Shearer CA, Motta JJ. (1973) Ultrastructure and conidiogenesis in Conioscypha (Hyphomycetes). Canadian Journal of Botany 51:1747–1751.
https://doi.org/10.1139/b73-226 - Shen H, Bao D, Wanasinghe DN, Boonmee S, Liu JK, Luo ZL. (2022) Novel species and records of Dictyosporiaceae from freshwater habitats in China and Thailand. Journal of Fungi 8:1200.
https://doi.org/10.3390/jof8111200 - Shenoy BD, Jeewon R, Wang HK, Amandeep K, Ho WH, Bhat DJ, Crous PW, Hyde KD. (2010) Sequence data reveals phylogenetic affinities of fungal anamorphs Bahusutrabeeja, Diplococcium, Natarajania, Paliphora, Polyschema, Rattania and Spadicoides. Fungal Diversity 44:161–169. https://doi.org/10.1007/s13225-010-0059-8
- Shenoy BD, Jeewon R, Wu WP, Bhat DJ, Hyde KD. (2006) Ribosomal and RPB2 DNA sequence analyses suggest that Sporidesmium and morphologically similar genera are polyphyletic. Mycological Research 110(8):916–928. https://doi.org/10.1016/j.mycres.2006.06.004
- Shi T, Wang H, Li YJ, Wang YF, Pan Q, Wang B, Shang EL. (2023) Genus Acrostalagmus: A prolific producer of natural products. Biomolecules 13(8):1191.
https://doi.org/10.3390/biom13081191 - Shirouzu T, Hirose D, Tokumasu S, To-Anun C, Maekawa N. (2010) Host affinity and phylogenetic position of a new anamorphic fungus Beltraniella botryospora from living and fallen leaves of evergreen oaks. Fungal Diversity 43:85–92.
https://doi.org/10.1007/s13225-010-0037-1 - Shivas RG, Hyde KD. (1997) Biodiversity of plant pathogenic fungi in the tropics. In Biodiversity of Tropical Microfungi (Hyde KD, Ed.). Hong Kong University Press, Hong Kong, China, pp. 47–56.
- Shu YX, Doilom M, Boonmee S, Xu B, Dong W. (2024) Three novel cheiroid hyphomycetes in Dictyocheirospora and Dictyosporium (Dictyosporiaceae) from freshwater habitats in Guangdong and Guizhou Provinces, China. Journal of Fungi 10:259.
https://doi.org/10.3390/jof10040259 - Sivanesan A (1971) The genus Herpotrichia Fuckel. Mycol Pap 127:1–37.
- Sivichai S, Hywel-Jones N. (1999) Biflagellospora (aero-aquatic hyphomycetes) from submerged wood in Thailand. Mycological Research 103(7):908–914.
https://doi.org/10.1017/S0953756298007928 - Slippers B, Boissin E, Phillips AJL, Groenewald JZ, Wingfield MJ, Postma A, Burgess T, Crous PW. (2013) Phylogenetic lineages in the Botryosphaeriales: a systematic and evolutionary framework. Studies in Mycology 76(1):31–49.
https://doi.org/10.3114/sim0020 - Smith G. (1962) Some new and interesting species of microfungi. III. Transactions of the British Mycological Society 45(3):387–394.
https://doi.org/10.1016/S0007-1536(62)80077-1 - Somrithipol S, Jones EBG. (2005) An addition to the hyphomycete genus Melanographium from Thailand. Fungal Diversity 19:137–144.
- Soprunov FF, Galiulina ZA. (1951) Predatory hyphomycetes from Turkmenistan soils. Mikrobiologiya 20:489–499.
- Spennemann DH. (2021) The role of Canary Island date palms in physical amenity provisioning for urban landscape settings. Horticulturae 7(7):201.
https://doi.org/10.3390/horticulturae7070201 - Steinbauer MJ, Grytnes JA, Jurasinski G, Kulonen A, Lenoir J, Pauli H, Rixen C, Winkler M, Bardy-Durchhalter M, Barni E, Bjorkman AD, Breiner FT, Burg S, Czortek P, Dawes MA et al. (2018) Accelerated increase in plant species richness on mountain summits is linked to warming. Nature 556(7700):231–234.
https://doi.org/10.1038/s41586-018-0005-6 - Su H, Hyde KD, Maharachchikumbura SSN, Ariyawansa HA, Luo ZL, Promputtha I, Tian Q, Lin CG, Shang QJ, Zhao YC, Chai HM, Liu XY, Bahkali AH, Bhat DJ, McKenzie EHC et al. (2016) The families Distoseptisporaceae fam. nov., Kirschsteiniotheliaceae, Sporormiaceae and Torulaceae, with new species from freshwater in Yunnan Province, China. Fungal Diversity 80:375–409.
https://doi.org/10.1007/s13225-016-0362-0 - Su P, Chen Y, Syed A, Bahkali AH, Maharachchikumbura SSN. (2023) Taxonomic novelty in Sichuan Province, China: Veronaea polyconidia sp. nov. (Herpotrichiellaceae), a new addition to hyphomycetous fungi. Phytotaxa 632(2):118–130.
https://doi.org/10.11646/phytotaxa.632.2.2 - Subramanian CV. (1952) Fungi Imperfecti from Madras—III: Beltraniella gen. nov. Proceedings of the Indian Academy of Sciences - Section B 36(6):223–228. New Delhi: Springer India.
https://doi.org/10.1007/BF03050466 - Subramanian CV, Vittal BPR. (1973) Three new Hyphomycetes from litter. Canadian Journal of Botany 51:1127–1132.
https://doi.org/10.1139/b73-142 - Sugita R, Hirayama K, Shirouzu T, Tanaka K. (2022) Spirodecosporaceae fam. nov. (Xylariales, Sordariomycetes) and two new species of Spirodecospora. Fungal Systematics and Evolution 10:217–229.
https://doi.org/10.3114/fuse.2022.10.09 - Sun YR, Hyde KD, Liu NG, Jayawardena RS, Wijesinghe NN, Ma J, Zhang Q, Al-Otibi F, Wang Y. (2025) Micro-fungi in southern China and northern Thailand: emphasis on medicinal plants. Fungal Diversity 131:99–299.
https://doi.org/10.1007/s13225-024-00549-4 - Sun YR, Liu NG, Samarakoon MC, Jayawardena RS, Hyde KD, Wang Y. (2021) Morphology and phylogeny reveal Vamsapriyaceae fam. nov. (Xylariales, Sordariomycetes) with two novel Vamsapriya species. Journal of Fungi 7:891.
https://doi.org/10.3390/jof7110891 - Sydow H, Sydow P. (1917) Beitrag zur Kenntnis der Pilzflora der Philippinen–Inseln. Annales Mycologici 15:12–268.
- Tanaka K, Harada Y. (2003) Pleosporales in Japan (2): the genus Lophiotrema. Mycoscience 44(2):115–121.
https://doi.org/10.47371/mycosci.MYC44115 - Tanaka K, Harada Y. (2005) Bambusicolous fungi in Japan (4): A new combination, Astrosphaeriella aggregata. Mycoscience 46(2):114–118.
https://doi.org/10.1007/s10267-004-0223-7 - Tanaka K, Hirayama K, Yonezawa H, Hatakeyama S, Harada Y, Sano T, Shirouzu T, Hosoya T. (2009) Molecular taxonomy of bambusicolous fungi: Tetraplosphaeriaceae, a new pleosporalean family with Tetraploa-like anamorphs. Studies in Mycology 64:175–209.
https://doi.org/10.3114/sim.2009.64.10 - Tanaka K, Hirayama K, Yonezawa H, Sato G, Toriyabe A, Kudo H, Hashimoto A, Matsumura M, Harada Y, Kurihara Y, Shirouzu T, Hosoya T. (2015) Revision of the Massarineae (Pleosporales, Dothideomycetes). Studies in Mycology 82:75–136.
https://doi.org/10.1016/j.simyco.2015.10.002 - Tao Y, Quan X, Khokhar I, Anjum T, Song H, Mukhtar I. (2021) First report of Pseudopestalotiopsis theae causing leaf spot of date palm (Phoenix dactylifera) in China. Plant Disease 105:508.
https://doi.org/10.1094/PDIS-06-20-1356-PDN - Taylor JE, Hyde KD, Jones EBG. (1996) Pulmosphaeria archontophoenicis gen. et sp. nov. associated with Archontophoenix alexandrae (Arecaceae) in Northern Queensland. Sydowia 48:255–262.
- Taylor JE, Hyde KD. (1999) Cannonia gen. nov., from palms in the Southern Hemisphere. Mycological Research 103:1398–1402.
https://doi.org/10.1017/S0953756299008795 - Taylor JE, Hyde KD, Jones EBG. (1999) Endophytic fungi associated with the temperate palm, Trachycarpus fortunei, within and outside its natural geographic range. New Phytologist 142:335–346.
https://doi.org/10.1046/j.1469-8137.1999.00391.x - Taylor JE, Hyde KD, Jones EBG. (2000) The biogeographical distribution of microfungi associated with three palm species from tropical and temperate habitats. Journal of Biogeography 27:297–310.
https://doi.org/10.1046/j.1365-2699.2000.00385.x - Tennakoon DS, de Silva NI, Maharachchikumbura SSN, Bhat DJ, Kumla J, Suwannarach N, Lumyong S. (2023) Exploring more on Dictyosporiaceae: the species geographical distribution and intriguing novel additions from plant litter. Diversity 15:410.
https://doi.org/10.3390/d15030410 - Tennakoon DS, Kuo CH, Maharachchikumbura SSN, Thambugala KM, Gentekaki E, Phillips AJL, Bhat DJ, Wanasinghe DN, de Silva NI, Promputtha I, Hyde KD. (2021) Taxonomic and phylogenetic contributions to Celtis formosana, Ficus ampelas, F. septica, Macaranga tanarius and Morus australis leaf litter inhabiting microfungi. Fungal Diversity 108:1–215.
https://doi.org/10.1007/s13225-021-00474-w - Tennakoon DS, Phookamsak R, Kuo CH, Goh TK, Jeewon R, Hyde KD. (2018) Morphological and phylogenetic evidence reveal Fissuroma taiwanense sp. nov. (Aigialaceae, Pleosporales) from Hedychium coronarium. Phytotaxa 338:265–275.
https://doi.org/10.11646/phytotaxa.338.3.4 - Tennakoon DS, Thambugala KM, de Silva NI, Song HY, Suwannarach N, Chen FS, Hu DM. (2024) An overview of Melanommataceae (Pleosporales, Dothideomycetes): Current insight into the host associations and geographical distribution with some interesting novel additions from plant litter. MycoKeys 106:43–96.
https://doi.org/10.3897/mycokeys.106.125044 - ter Steege H, Pitman NCA, Sabatier D, Baraloto C, Salomão RP, Guevara JE, Phillips OL, Castilho CV, Magnusson WE, Molino JF, Monteagudo A, Núñez Vargas P, Montero JC, Feldpausch TR, Honorio Coronado EN et al. (2013) Hyperdominance in the Amazonian tree flora. Science 342(6156): 1243092.
https://doi.org/10.1126/science.1243092 - Thiyagaraja V, Ertz D, Hyde KD, Karunarathna SC, To-Anun C, Cheewangkoon R. (2022) Morphological and phylogenetic reassessment of Sclerococcum simplex from China. Phytotaxa 559(2):167–175.
https://doi.org/10.11646/phytotaxa.559.2.5 - Thiyagaraja V, Hyde KD, Piepenbring M, Davydov EA, Dai DQ, Abdollahzadeh J, Bundhun D, Chethana KWT, Crous PW, Gajanayake AJ, Gomdola D, Haelewaters D, Johnston PR, Mardones M, Perera RH et al. (2025) Orders of Ascomycota. Mycosphere 16(1):536–1411.
https://doi.org/10.5943/mycosphere/16/1/8 - Tian Q, Liu JK, Hyde KD, Wanasinghe DN, Boonmee S, Jayasiri SC, Luo L, Taylor JE, Phillips AJL, Bhat DJ, Li WJ, Ariyawansa HA, Thambugala KM, Jones EBG, Chomnunti P et al. (2015) Phylogenetic relationships and morphological reappraisal of Melanommataceae (Pleosporales). Fungal Diversity 74:267–324.
https://doi.org/10.1007/s13225-015-0350-9 - Tian WH, Liu JW, Jin Y, Chen YP, Zhou YF, Wu K, Su PW, Guo XY, Wanasinghe DN, Hyde KD, Liu JK, Maharachchikumbura SSN. (2024a) Morphological and phylogenetic studies of Ascomycota from gymnosperms in Sichuan Province, China. Mycosphere 15(1):1794–1900.
https://doi.org/10.5943/mycosphere/15/1/16 - Tian XG, Bao DF, Karunarathna SC, Jayawardena RS, Hyde KD, Bhat DJ, Luo ZL, Elgorban AM, Hongsanan S, Rajeshkumar KC, Maharachchikumbura SSN, Suwannarach N, Dawoud TM, Lu YZ, Han JJ et al. (2024b) Taxonomy and phylogeny of ascomycetes associated with selected economically important monocotyledons in China and Thailand. Mycosphere 15(1):1–274.
https://doi.org/10.5943/mycosphere/15/1/1 - Tibpromma S, Hyde KD, McKenzie EHC, Bhat DJ, Phillips AJL, Wanasinghe DN, Samarakoon MC, Jayawardena RS, Dissanayake AJ, Tennakoon DS, Doilom M, Phookamsak R, Tang AMC, Xu J, Mortimer PE et al. (2018) Fungal diversity notes 840–928: micro-fungi associated with Pandanaceae. Fungal Diversity 93:1–160.
https://doi.org/10.1007/s13225-018-0408-6 - Tibpromma S, Hyde KD, Jeewon R, Maharachchikumbura SSN, Liu JK, Bhat DJ, Jones EBG, McKenzie EHC, Camporesi E, Bulgakov TS, Doilom M, Santiago ALCMD, Das K, Manimohan P, Gibertoni TB et al. (2017) Fungal diversity notes 491–602: taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 83:1–261.
https://doi.org/10.1007/s13225-017-0378-0 - Toapanta-Alban CE, Ordoñez ME, Blanchette RA. (2022) New findings on the biology and ecology of the Ecuadorian Amazon fungus Polyporus leprieurii var. yasuniensis. Journal of Fungi 8(2):203.
https://doi.org/10.3390/jof8020203 - Torrend C. (1912) Deuxième contribution pour l'étude des Champignons de l'ile de Madère. Brotéria Série Botânica 10:29–49.
- Torres-Garcia D, García D, Réblová M, Jurjević Ž, Hubka V, Gené J. (2023) Diversity and novel lineages of black yeasts in Chaetothyriales from freshwater sediments in Spain. Persoonia - Molecular Phylogeny and Evolution of Fungi 51:194–228.
https://doi.org/10.3767/persoonia.2023.51.05 - Trakunyingcharoen T, Lombard L, Groenewald JZ, Cheewangkoon R, To-Anun C, Crous PW. (2015) Caulicolous Botryosphaeriales from Thailand. Persoonia - Molecular Phylogeny and Evolution of Fungi 34:87–99.
https://doi.org/10.3767/003158515X685841 - Trierveiler-Pereira L, Agra LANN, Capdet M, Romero AI. (2012) Cannonia australis (Xylariaceae, Ascomycota) found in equatorial Brazil. Darwiniana 50:170–173.
- Untereiner WA. (2000) Capronia and its anamorphs: exploring the value of morphological and molecular characters in the systematics of the Herpotrichiellaceae. Studies in Mycology 45:141–148.
- U.S. Department of Energy. (2014) EnergyPlus™ documentation library (Version 8.2). National Renewable Energy Laboratory.
https://bigladdersoftware.com/epx/docs/8-2/getting-started/energyplus-documentation-library.html - Valenzuela-Lopez N, Magaña-Dueñas V, Cano-Lira JF, Wiederhold N, Guarro J, Stchigel AM. (2019) Two new species of Gloniopsis (Hysteriales, Ascomycota) from clinical specimens: morphological and molecular characterisation. Mycoses 62(12):1164–1173.
https://doi.org/10.1111/myc.13006 - Van Horn BM, Nguyen Q. (2023) Hands-on application development with PyCharm: build applications like a pro with the ultimate Python development tool. Packt Publishing Ltd.
- Van Rossum G, Drake FL Jr. (1995) Python tutorial (Vol. 620). Centrum voor Wiskunde en Informatica, Amsterdam, The Netherlands.
- Vilgalys R, Hester M. (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172(8):4238–4246.
https://doi.org/10.1128/jb.172.8.4238-4246.1990 - Wanasinghe DN, Jeewon R, Jones EBG, Boonmee S, Kaewchai S, Manawasinghe IS, Lumyong S, Hyde KD. (2018) Novel palmicolous taxa within Pleosporales: multigene phylogeny and taxonomic circumscription. Mycological Progress 17:571–590.
https://doi.org/10.1007/s11557-018-1379-4 - Wanasinghe DN, Ren GC, Xu JC, Cheewangkoon R, Mortimer PE. (2022) Insight into the taxonomic resolution of the pleosporalean species associated with dead woody litter in natural forests from Yunnan, China. Journal of Fungi 8(4):375.
https://doi.org/10.3390/jof8040375 - Wang JY, Zhang K, Yang CL, Xia JW, Ma YR, Gao JM, Li XY, Zhang XG, Cai YM. (2016) Podosporium bacilliforme sp. nov. and a first record of Phaeoblastophora peckii from southern China. Mycotaxon 131(4):841–846.
https://doi.org/10.5248/131.841 - Wang M, Zhang LM, Liu XZ. (2005) Verticimonosporium verticale sp. nov. from Jiangxi Province, China. Mycotaxon 92:197–200.
- Wang WP, Bhat DJ, Yang L, Shen HW, Luo ZL. (2024) New species and records of Pleurotheciaceae from karst landscapes in Yunnan Province, China. Journal of Fungi 10(8):516.
https://doi.org/10.3390/jof10080516 - Wang Y, Hyde KD, McKenzie EHC, Jiang YL, Li DW, Zhao DG. (2015) Overview of Stachybotrys (Memnoniella) and current species status. Fungal Diversity 71(1):17–83.
https://doi.org/10.1007/s13225-014-0319-0 - Wendt L, Sir EB, Kuhnert E, Heitkämper S, Lambert C, Hladki AI, Romero AI, Luangsa-ard JJ, Srikitikulchai P, Peršoh D, Stadler M. (2018) Resurrection and emendation of the Hypoxylaceae, recognised from a multigene phylogeny of the Xylariales. Mycological Progress 17(1):115–154.
https://doi.org/10.1007/s11557-017-1311-3 - White TJ, Bruns T, Lee S, Taylor J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications 18(1):315–322.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1 - Whitton SR, McKenzie EHC, Hyde KD. (2002) Microfungi on the Pandanaceae: two new species of Camposporium and key to the genus. Fungal Diversity 11:177–187.
- Wijesinghe SN, Wang Y, Camporesi E, Wanasinghe DN, Boonmee S, Hyde KD. (2020) A new genus of Bambusicolaceae (Pleosporales) on Corylus avellana (Fagales) from Italy. Biodiversity Data Journal 8:e59058.
https://doi.org/10.3897/BDJ.8.e59058 - Wingfield MJ, de Beer ZW, Slippers B, Wingfield BD, Groenewald JZ, Lombard L, Crous PW. (2012) One fungus, one name promotes progressive plant pathology. Molecular Plant Pathology 13:604–613.
https://doi.org/10.1111/j.1364-3703.2011.00768.x - Wu N, Dissanayake AJ, Chethana KWT, Liu JK. (2022) Neodeightonia septate sp. nov. and N. subglobosa (Botryosphaeriaceae) from northern Thailand. Phytotaxa 575(2):129–139.
https://doi.org/10.11646/phytotaxa.575.2.2 - Wu WP, Diao YZ. (2022) Anamorphic chaetosphaeriaceous fungi from China. Fungal Diversity 116:1–546.
https://doi.org/10.1007/s13225-022-00509-w - Wu Y, Peng C, Yuan R, Zhang M, Hu Y, Tian C. (2024) New species and records of Botryosphaeriales (Dothideomycetes) associated with tree dieback in Beijing, China. MycoKeys 106:225–250.
https://doi.org/10.3897/mycokeys.106.122890 - Xia JW, Ma YR, Gao JM, Li Z, Zhang XG. (2016) Sympodiosynnema, a new genus of dematiaceous hyphomycetes from southern China. Mycotaxon 131(1):45–48.
https://doi.org/10.5248/131.45 - Xia JW, Ma YR, Li Z, Zhang XG. (2017) Acrodictys-like wood decay fungi from southern China, with two new families Acrodictyaceae and Junewangiaceae. Scientific Reports 7:7888.
https://doi.org/10.1038/s41598-017-08318-x - Xia JW, Mu TC, Zhang ZX, Li Z, Zhang XG. (2022) Neoacrodictys elegans gen. & sp. nov. from Hainan Province, China. Mycotaxon 137:63–71.
https://doi.org/10.5248/137.63 - Xiong YR, Manawasinghe IS, Hyde KD, Taylor JE, Phillips AJL, Pereira DS, Lu L, Zhang SN, Mapook A, Xu B. (2024) Introducing palmfungi.org, an integrated fungal-host data platform. Biodiversity Data Journal 12:e126553.
https://doi.org/10.3897/BDJ.12.e126553 - Xiong YR, Manawasinghe IS, Liao CF, Hyde KD, Dong ZY. (2022b) Neodeightonia arengae sp. nov., botryosphaeriaceous taxa on Arenga tremula (Arecaceae) from Guangdong, China. Phytotaxa 530:130–140.
https://doi.org/10.11646/phytotaxa.530.2.1 - Xiong YR, Manawasinghe IS, Maharachchikumbura SSN, Lu L, Dong ZY, Xiang MM, Xu B. (2022a) Pestalotioid species associated with palm species from southern China. Current Research in Environmental & Applied Mycology (Journal of Fungal Biology) 12(1):285–321.
https://doi.org/10.5943/cream/12/1/18 - Xiong YR, Manawasinghe IS, Wanasinghe DN, Hongsanan S, Hyde KD, Xu B, Dong ZY. (2023) Two new species and a new host record of Pleosporales (Dothideomycetes) from palm (Arecaceae) in Guangdong Province, China. New Zealand Journal of Botany 62(1):1–27.
https://doi.org/10.1080/0028825X.2023.2258583 - Xu CY, Song HY, Zhou JP, Zhai ZJ, Cui CY, Hu DM. (2025) Four new or newly recorded species from freshwater habitats in Jiangxi Province, China. Journal of Fungi 11:79.
https://doi.org/10.3390/jof11010079 - Xu RJ, Thiyagaraja V, Li Y, Zhou DQ, Boonmee S, Zhao Q. (2024) Two novel lignicolous freshwater fungi, Conioscypha xizangensis and Cordana linzhiensis, from the Tibetan Plateau, China. New Zealand Journal of Botany.
https://doi.org/10.1080/0028825X.2024.2336044 - Xu RJ, Zhu YA, Liu NG, Boonmee S, Zhou DQ, Zhao Q. (2023) Taxonomy and phylogeny of hyphomycetous muriform conidial taxa from the Tibetan Plateau, China. Journal of Fungi 9:560.
https://doi.org/10.3390/jof9050560 - Yang EF, Dai DQ, Bhat JD, Dawoud TM, Promputtha I, Adikaram N, Stephenson SL, Karunarathna SC, Tibpromma S. (2023a) Taxonomic and phylogenetic studies of saprobic fungi associated with Mangifera indica in Yunnan, China. Journal of Fungi 9(6):680.
https://doi.org/10.3390/jof9060680 - Yang EF, Tibpromma S, Karunarathna SC, Phookamsak R et al. (2022) Taxonomy and phylogeny of novel and extant taxa in Pleosporales associated with Mangifera indica from Yunnan, China (Series I). J Fungi 8:152.
- Yang J, Liu JK, Hyde KD, Jones EBG, Liu ZY. (2018a) New species in Dictyosporium, new combinations in Dictyocheirospora and an updated backbone tree for Dictyosporiaceae. MycoKeys 36:83–105.
https://doi.org/10.3897/mycokeys.36.27051 - Yang J, Maharachchikumbura SSN, Liu JK, Hyde KD, Jones EBG, Al-Sadi AM, Liu ZY. (2018b) Pseudostanjehughesia aquitropica gen. et sp. nov. and Sporidesmium sensu lato species from freshwater habitats. Mycological Progress 17:591–616.
https://doi.org/10.1007/s11557-017-1339-4 - Yang J, Liu LL, Jones EBG, Hyde KD, Liu ZY, Bao DF, Liu NG, Li WL, Shen HW, Yu XD, Liu JK. (2023b) Freshwater fungi from karst landscapes in China and Thailand. Fungal Diversity 119:1–212.
https://doi.org/10.1007/s13225-023-00514-7 - Yang J, Liu LL, Jones EBG, Li WL, Hyde KD, Liu ZY. (2021) Morphological variety in Distoseptispora and introduction of six novel species. Journal of Fungi 7:945.
https://doi.org/10.3390/jof7110945 - Yang T, Groenewald JZ, Cheewangkoon R, Jami F, Abdollahzadeh J, Lombard L, Crous PW. (2017) Families, genera, and species of Botryosphaeriales. Fungal Biology 121:322–346.
https://doi.org/10.1016/j.funbio.2016.11.001 - Yang YH, Manawasinghe IS, Wanasinghe DN, Farias ARGD, Liao CF, Dong ZY. (2024) A novel genus and new records of Dothideomycetes associated with Litchi chinensis litter from Guangdong Province, China. New Zealand Journal of Botany 62(2–3):216–238.
https://doi.org/10.1080/0028825X.2023.2274628 - Yanna, Ho WH, Hyde KD. (2001) Fungal communities on decaying palm fronds in Australia, Brunei, and Hong Kong. Mycological Research 105:1458–1471.
https://doi.org/10.1017/S0953756201005214 - Youssef FS, Simal-Gandara J. (2021) Comprehensive overview on the chemistry and biological activities of selected alkaloid producing marine-derived fungi as a valuable reservoir of drug entities. Biomedicines 9:485.
https://doi.org/10.3390/biomedicines9050485 - Yu XD, Zhang SN, Cheewangkoon R, Liu JK. (2021) Additions to Occultibambusaceae (Pleosporales, Dothideomycetes): unrevealing palmicolous fungi in China. Diversity 13:516.
https://doi.org/10.3390/d13110516 - Yu XD, Zhang SN, Liang XD, Zhu JT, Hyde KD, Liu JK. (2024) Bambusicolous fungi from Southwestern China. Mycosphere 15(1):5038–5145.
https://doi.org/10.5943/mycosphere/15/1/24 - Yuan HS, Lu X, Dai YC, Hyde KD, Kan YH, Kušan I, He SH, Liu NG, Sarma VV, Zhao CL, Cui BK, Yousaf N, Sun GY, Liu SY, Wu F et al. (2020) Fungal diversity notes 1277–1386: taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 104:1–266.
https://doi.org/10.1007/s13225-020-00461-7 - Zare R, Gams W, Schroers HJ. (2004) The type species of Verticillium is not congeneric with the plant pathogenic species placed in Verticillium and it is not the anamorph of 'Nectria inventa'. Mycological Research 108:576–582.
https://doi.org/10.1017/S0953756204009839 - Zelski SE, Raja HA, Miller AN, Shearer CA. (2015) Conioscypha peruviana sp. nov., its phylogenetic placement based on 28S rRNA gene, and a report of Conioscypha gracilis from Peru. Mycoscience 56:319–325.
https://doi.org/10.1016/j.myc.2014.09.002 - Zeng XY, Tan TJ, Tian FH, Wang Y, Wen TC. (2023) OFPT: A one-stop software for fungal phylogeny. Mycosphere 14(1):1730–1741. https://doi.org/10.5943/mycosphere/14/1/20
- Zhang H, Dong W, Hyde KD, Maharachchikumbura SSN, Hongsanan S, Bhat DJ, Al-Sadi AM, Zhang D. (2017) Towards a natural classification of Annulatascaceae-like taxa: introducing Atractosporales ord. nov. and six new families. Fungal Diversity 85:75–110.
https://doi.org/10.1007/s13225-017-0387-z - Zhang JF, Liu JK, Hyde KD, Chen YY, Ran HY, Liu ZY. (2023) Ascomycetes from karst landscapes of Guizhou Province, China. Fungal Diversity 122:1–160.
https://doi.org/10.1007/s13225-023-00524-5 - Zhang JY, Hyde KD, Bao DF, Hongsanan S, Liu YX, Kang JC, Luo ZL, Liu JK, Lu YZ. (2025) A worldwide checklist and morpho-molecular systematics of fungi associated with pteridophytes. Fungal Diversity 132:151–423.
https://doi.org/10.1007/s13225-025-00554-1 - Zhang JY, Ma J, Xiao YP, Boonmee S, Kang JC, Lu YZ. (2022) Morphological and phylogenetic analyses reveal five new species in Chaetosphaeriaceae. Journal of Fungi 8(6):643.
https://doi.org/10.3390/jof8060643 - Zhang SN, Hyde KD, Jones EBG, Cheewangkoon R, Liu JK. (2020) Additions to Fissuroma and Neoastrosphaeriella (Aigialaceae, Pleosporales) from palms. Mycosphere 11:269–284. https://doi.org/10.5943/mycosphere/11/1/5
- Zhang SN, Hyde KD, Jones EBG, Yu XD, Cheewangkoon R, Liu JK. (2024) Current insights into palm fungi with emphasis on taxonomy and phylogeny. Fungal Diversity 127:55–301.
https://doi.org/10.1007/s13225-024-00536-9 - Zhang T. (2019) Flora Fungorum Sinicorum, Vol. 51, Dematiaceous hyphomycetes from soil. Science Press, Beijing, 322–328 pp.
- Zhang W, Groenewald JZ, Lombard L, Schumacher RK, Phillips AJL, Crous PW. (2021) Evaluating species in Botryosphaeriales. Persoonia - Molecular Phylogeny and Evolution of Fungi 46:63–115.
https://doi.org/10.3767/persoonia.2021.46.03 - Zhang Y, Fournier J, Bahkali AH, Hyde KD. (2011) Inflatispora, a novel lignicolous genus of Pleosporales from France. Sydowia 63:287–295.
- Zhang Y, Schoch CL, Fournier J, Crous PW, de Gruyter J, Woudenberg JHC, Hirayama K, Tanaka K, Pointing SB, Spatafora JW, Hyde KD. (2009) Multi-locus phylogeny of Pleosporales: a taxonomic, ecological and evolutionary re-evaluation. Studies in Mycology 64:85–102.
https://doi.org/10.3114/sim.2009.64.04 - Zhao H, Mapook A, Hyde KD, Doilom M, Al-Otibi FO, Saichana N, Dong W. (2025) Xylolentia bambusae (Rhamphoriaceae, Rhamphoriales), a novel species associated with dead bamboo in Guangdong Province, China. Phytotaxa 681(2):211–222.
https://doi.org/10.11646/phytotaxa.681.2.6 - Zhao HJ, Doilom M, Mapook A, Wang G, Hyde KD, Dong W. (2024) New insights into Tetraplosphaeriaceae based on taxonomic investigations of bambusicolous fungi and freshwater fungi. Journal of Fungi 10:319.
https://doi.org/10.3390/jof10050319 - Zhou DQ, Hyde KD. (2001) Host-specificity, host-exclusivity, and host-recurrence in saprobic fungi. Mycological Research 105:1449–1457.
https://doi.org/10.1017/S0953756201004713 - Zogg H. (1962) Die Hysteriaceae s. str. und Lophiaceae unter besonderer Berücksichtigung der mitteleuropäischen Formen. Beiträge zur Kryptogamenflora der Schweiz, Vol. 11. Kommissionsverlag Buchdruckerei Büchler & Co., Bern.
- Zuur AF, Ieno EN, Walker NJ, Saveliev AA, Smith GM. (2009) Mixed effects models and extensions in ecology with R. Springer, New York, 574 pp. https://doi.org/10.1007/978-0-387-87458-6